Spermophilus_tridecemlineatus Locus Mono:188:SNORA18
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:188:SNORA18
Spermophilus_tridecemlineatus
Mono:188:SNORA18
GeneScaffold_1397
SNORA18
1001..1130
2130
TGCCTTGACTCCAGGCCCCATTACCTTCAATCCACATTATAGCCATGTTCCCAGGAGAG
CCTTTCCTAAGTACTACTTTATACCATGTTGTTTCTTTGTTCAAAAACCTACATGGGGCT
AGTCAATTCACACTGTACTAAACTTAAACTCCTCCTCTTATTTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGTCCCGCCTGTGCTAGGCGAGCGCTCTACCGCTGA
GCCACAATCCCAGGCCCTACAAAGGATTAAAAAAAAAAAAAAAAAACTAAGCATTTAATT
TATCAGGCACCATTCTAATAGCTTTACATGTTTTTCTTTGTTTTGGTGAAGGGGATTAAA
TCCAGGGCCTCACATTTACATGCATTTATTCTCATATAATCTTCAAAACAACCATAGGAG
ATAAACAGCTATTCTTTCCATTTTATAGGTGAGAACATTAAAAATCGAAGAAGAAAAGAA
AGTTACTGAAAGTTATTCAAGTTGAAAATGGCAAAGGCGGGGTTCTGTCACAAATCCTAT
TCCAGATACAATTTCATCATGACAGAAATCTGGGCCCTTGTCTTTTTTTTTTTTTTTTTA
ATAATTTTTAAATTGTAGATAGACACAATACCTTTATTTTATTTATTATTTTTTTTTAGT
GTGGTATTGAGGATTGAACCTAGTGCCTCACATGTACAAGGCAAGCGCTCTGCCACTGAG
CTACAATCCAAGTCTTGGGCCCTTGTTTTTTTATAATCTGTTCCTTCTCACCAATCCCAC
TTTGTTTCCCAGAAGATTCAAAAATGTACTCAAATCATAAGTTTCTTCAAAGACCCAAGA
ATATACTAAAATTATTCCCATCCGAATTTTTTTGTCTTCACATTACCATCTTCAAAAGAA
TTATTTTTAAATTTTTACTAATCTTTTAAAATAAAGCTCAGGTGGAGGTCCATCCTGATA
GGGCCTTTCCTATAGCCACACATTGCTGTAAATACCTGATAGAGTAACTATGGTTTTACT
TTACTCACAGAACTATTTGTTAGATCTATGAGAAAGAACTAAAGGATAGTTACAATAATA
AACTTTTTACCTTAGGTATCAGTATATCCCACAGATCTATACCAAATATGATTTGACTCA
TTCATGATTACAGATGGTATCAGTAATTGAAAACCAGGCAGTCTGGCTACTCTAAAAATG
ACCCTAAAGTAAAAGAAATTAAATCCCAAAGATTCCAGAAAGGGAATTTTGAAGTTGTTA
TCAGTGTGTCCATAATTCAAAGTGGAGAGAAAAGCAGCCCATATAAAAGGATCATGGCCT
GATATTACAACTGTGGATACAGCATCAGTGTTTAGGGGGGTTTTGTTTGTTTATTTTTAA
GGGCTATTTTGGAGATAAATCTTGACTCAAGAAGAATAAAAGTGACCTAGATGGGTAATG
GAAGGAATCACAACACATGAAATTTCTTTAAATAAAAGTGGATGGGGGGCTGGGGATGTG
GCTCAAGCGGTAGCGCGCTCGCCTGGCATGCGTGCGGCCCAGGTTCGATCCTCAGCACCA
CATACAAACGAAGGTGTTGTGTCCGCCGAGAACTAGAGAATAAATATTAAAAAATCCTCT
CTCTCTCTCTCTCTTTAAAAAAAAAAAAAAAAAAAAAGTGGATGGACTTAGACACGAATT
GGTGTGAAACTTTGTATACAACCAGAGATGTAAAAAATTGTGCTCTATATGTATAAGAAT
TATAATGCATTCTGCTGTCATAAATACATAATTAATTTTTAAAAAGAAAAAAGCATGTGA
TATTAATAAAAAGCATAAATTGCCTTGTTTAAAAAAATGAATTGATTTTTTAAAATAATA
AAATAAAGCTCAAGTTCTATCCTTCCTGAACTATCTCAGCTCTTTGTTCCTCTAGATTCC
TACAATATTTAGACTCTTTCAGCACTGTATATAATAATTGTCATTGCTCATACTTGTTTT
CTCAGTGTTAGTCTTCTCTTCCCCGGGGTGATTGTAATTGAGGCTGGGCCCATGTTTTAT
ACTTTTTGTATCAAAAAAGAAAATGGAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved