Spermophilus_tridecemlineatus Locus Mono:49:SNORA15
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:49:SNORA15
Spermophilus_tridecemlineatus
Mono:49:SNORA15
scaffold_13909
SNORA15
1001..1140
2140
GCTGAGTTATCGGCAGACACAACATCTTTGTTGGTATGTGGTGCTGAGGATCGAACCCG
GGCCGCACGCATGCCAGGCCAGCGCGCTACCGCTTGAGCCACATCCCCAGCCCCTGGGTT
TTTTTTTTTTTTTTTTTTTTTTAAAAAGGCTAGGATATGGCTCATTGGAGCACTTGGCTA
GCACATGCAAGGCCCCAAATTCGATCCCTAATACCAGGGGTGCAGGGTCATATTTGAAGC
CTATTTGCTGGCTGTGGGGGAGGGTGGCTTTAACAGGTTAAAAGAAAAGATCCTTTTCAG
CTGATTATTGATGAATGGAAAGGCTTAGGTTGAAATATTTTTGAGAATGCAATTTTAGCC
TGTAATTCTGGAGATTTCTTCCTGACAGTGGTTAGTCTTCTCTTTGAGCGTAACTGCTGA
TGCTGCTGACACGTTTCACACTTTACCCTTTCAGGCTGACTCTTGCTTGTGGTGGGGTGG
CTCTGAATTCTCTTGATGACCTCAGTCCTGACTGCCTGGGCTATGCAGGACTTGTCTATG
AGTATACCTTGGTAAGTGTGTTTTCCTCCCAAACCTGAATTCCTCAGTAGAAAAGTTTAA
ATTCAGGATCAGGTTTTTCTTTGTTTATATACGTTTTGTTGTTTGTTTTTTTCCATTGGC
ATGGAAAAAAATGACAATCTTTACTAAATTTGGCTTTAATATGGTCAGTATAATTAGTAT
GATTAATATGCTATTTATCCTCTCCGTATACTCCTCTCCTGTTCACTCTTTGTATATATT
CTGGTTTTGAAAATCTCTCTTACAGGGAGAAGAGAAGTTCACCTTTATTGAGAAATGTAA
CAATCCCCGTTCTGTCACATTATTAGTCAAAGGACCAAATAAGCACACACTCACTCAGAT
CAAAGATGCTATACGCGATGGCTTAAGGGCAGTCAAATATGCACTCGATGATGGTAAGAG
CTCATTGTGTTTAAATCTTGTTCTTTTTGCTAGTGTAAAAAGCATGGCTGAATACTGTGT
ACTTTAGTCAGTATTTTACACAGCCAGACACCATGCAAAAGTAAAAGTCTTCCTTTTATA
ATAACTGTGGTATGCTAAAGGTTTTTTCATAAGTGTGCCCCTATAAAAAGTGGATACAGA
CAAATGAACTAACACATGCTTCAGAGAAGTGCCCAGCTCAAATTGAACTATTGTGCTGTT
AGGTTTGTCCCTTTGCATGTGGGTTGGGGTGGGTCCCTCAGTGGTAGAAAGTTGATCAAT
TACATGGAGGCCCAATTAAAATCCCAAGCGTCTCTAGAGAATAACAAAATTAATCCTGTG
GTACAACTTCTCATCTCGTTCACCGTGAATACTCTTGATATTAATTTATTTTATTTTTTT
TATAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved