Spermophilus_tridecemlineatus Locus Poly:11:SNORD22
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:11:SNORD22
Spermophilus_tridecemlineatus
Poly:11:SNORD22
GeneScaffold_5925
SNORD25, SNORD26, SNORD29, SNORD30, SNORD31, SNORD22
1001..1069, 1274..1348, 2361..2426, 2606..2673, 2885..2953, 3184..3310
4310
AAATAGGATCAGACAGAAGCTGGTGGCCGGTCAGGACAAATCAGACCCTGTCTTCAGAA
TTAAGTGGAGTACTTACACCCTGACTTACTTTCCCCATATGGGACTTCCACTAGAGGTCA
GCACGGGGCCCAGTACCTGAGTCGCCCCCCGCGTTGTAACCCTGGACATCAGCCCCTGAA
AGGGCGCTGGGAGGCTGGCGCGGAATGGAGAGGTCGCGGGTCGAGGGCTCATGAGGTTCA
GAATCCATGGAGGCGGCTCTGCACACAGGTGTAACGTGTGGGGATGTAAGAGGGAAATCA
GGACAGGGTGCAAGGGTAGGCCTAGCGGTGACCGGAACAATTAGCCCAGGATCCGCCCCA
AGCAGGGATCTTCAGAATTGCGACCACACCCGCAGTAAAGCCAGAGCCGCCGAGACGCAA
ACCGCTCGGCGCGCCTGCGCACTCCCATGGGGCGCAAGCGCTTCTTTTTCGCGCCTCAAG
TTCTGTGACCCAGCGTTCAGTTCGACACCCGCCCTTCCCTAGAATTCTCAACCCACAATT
CCTCAAGGTTGTGGTGGCGTGCCATATGCGCGTGCGCTCGCTTTGTGCCCGCCCCCAATC
CCGTGGGCCTTTGCGTGAAAGTATTTAAGCGTCTCGCGTCGTTTTATTCGGTCTCATTTT
TCCTTCCAGGCTCCGGTGAGTATATGGGTTGGTGGGTTTCTCGGTTCTGTCTTAATTTAT
TTCGCGGCATGGCATATTGGGCTCAGCGGTATTTTAGCCACTGAGCCACTCTTTGACTTT
TGAGTCTTCTTAAGCTGCCTAACCTGAACTCGACCTATCGATCCTATTGTCATTATCTCC
GGAGTCGCTGCCATTATAGCCATTAGGTCGCGCGCTCCAGATCTCTATTGTCTTACCTAT
TGGCGGGCTGGGAGGGAAGATCTCCCGGACCTATTCAGTTATTCCTAAGCATTGGGGCTT
TGTGAAGGACAAAATGGCGGTAGCGGGCCGAGCCAGGCGCCCTCCCAGTGATGAGGACAT
TTTCACAGACCTGTACTGAACTCCGTGAGGATAAGTAACTCTGAGGAGACCGGCGCTGCA
CAGCTTGTGCCCCCTGCGGCCGTTGCTTTGTAGAAAGCATTTTTAAAAATATCCTATACT
AATCTAATGTTTTGTCTGCAGGGTCAAGACGCACATTCGCCACACAACAATCGAAGACAG
CCCTCTGGTTGGAGTAAGTGGTTTTGGCCGTCTAGTTCTTGTTCTTTGGTGGGCTGGAAG
AACTACTGGATGTGCTACAGGGATGATTTACGATTTGAACTCTCTCTTTCTGATGGTTTA
GTGGAGAAAATGTAAAAGTTCTGAGTAGCGCTACCCAGAAGTTTGTTTTCCTTGGGTTTT
AAGTTGAGGTGTTAGTGAAGGGTGTTCTATTTTCAGGTGTGCCTTAGCTCAAAGATGTGT
GGTGTCTGGAGAATGCACGGAGATCATTCCTGCGATTACAGCGATCCTCCATGTAGGTAT
ATATGGCTTGTGGAAAGGGAGCGTTTCTGGATAACCACTCTGTGATGAACATAAAACGAC
AAGCATATGACTGAGTTATAAGTGATGTCATCTTAATCCTGAGGAGTGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCCAGTAAGAACAGACATCCTGTCTTTACCCCCTGCTCCTAGTC
CCCAGACCCAGTAATGGTGAATCCACTGTAGCTGGAAGAGGAGGATGGAAACTTGGGTCC
CATGAGGTCCAGCAAAATGGCAAATAGCATTTGCTTTGCTGTCATTAATACTAGCTGGAT
ATTTGGAGTACTTTTGCTAATTTAGTGTTTTTCTGATTCAGGAGCAACTCATTTGTATAT
ACTGCTGAAAATACTCTGCTCAACATTAGCAGGTTAGTAGGGTTTTTTCCTGATTCATGG
CTTATGCCACCAAGTAGGAAGTTTCTATGATGACCCCAAACTAGCTCACTATGATTGACA
ATGAAAATATATGAACACCTGAGAAACTGAAGGATATAGAAGTGGGCAATATCCTGATAT
GCCACATATACATAGTATTTTATATGTTCTTAAATTTTTCAGGTGCTGTTACCAATATCT
ACTTACTGGTTCAAAGGTGAGTAATTTCAGTATGTATTAAGTATATATAGCATATTGGGT
AGGAAAAAGTGCCTTTTTCGGCAAATATATATGATGACTTATGGAATCTCGTTCGGCTGA
TGTTTTGCTGTTGAGACTCGGAAATCTGATTTCCTAGAAATAATAGGTGGGGATAACTGA
GGCAGGACATAAGCATTACTCATTTGATCTTGTTTGTTTCAGGTCTAGCATCTTGTCTGG
AACCCAGGAGTTATTTGAGGTACATACCTTTGCAATATTTATGGTTATCATATAGCATCG
ACTTTATCCTGTGGTGATACTTTGGTCTGAGTAGCCATATTTCGATCACCAATGGTGAAT
TCCTGCTCACCAGTGATGAGTTGAATACCGCCCCAGTCTGATCATTGTGACAGAAAGGTA
CACTCTGAGTTGTGAGCTCATCTTAACAGTGATAAACTATAGCAATAAGAAGATAGGCTT
TATAGCCAATAACTTTCTAAGACTAGGTTTTTATGAAGTGTGCTTTTCCTTTAAGCAATA
AATAGATGACTTAATTCCTAATCTCTTTCCATTACAGAGAAAGCAAGTCATGTCTGCCTA
ACTTCAACCTGAAGTTAAAGGTAAGTGGACTAAGGTGAAGGTAAAGTACAGTAAGCTAAA
AATTTCCCAATGAAGAAACATTTCACACGTCTTACTTCCTGTCCTAGTCCCAGAGCCTGT
AAAGGTGAACCCACTGGGGCTGGCTGGGGGAGAAGAGGAAAGCTTGTTCCAGAAGGAACT
GTCTGAGGGATGATCAGAATTTCTATAAATGGAAAATGGAAGAATGATCAGTTAGAGATC
AAACTGTTTTTGTTTTCCCATCCAGTAAAGATTCTTCTTTCCTCAGCAGGCATCCATCCA
AGTCTTGGAGGACATCAGATTTCCAGATCTTTTCTTGTGCATCCTAGCTGTTCAAGTTAA
CACACAATCATTTTGACTTTCCAAATAAAGTTCTTTTTCTTAAATCTGTGTGATTCATTG
CTTTGGTTGAGTCTCACTGGCAGTATGGGCATCTCTGAATTTTAATTGGCCCTAAGCAAC
ATGCCCCATCTCAAGAACAAGGCCTGGCGATGTGGTTCAGTGGTAAAGCACCCCTTTCCA
GGACCAATGCAACACATTGGAAGAGGAAGGGGGTGGTTCATGGGTGCCAAGAGGTGATGA
GCCACAGCAGTTATATTTGGTGCCCAGGACTGGTGGGGTTTGAGGGTGCATAGGATTGAA
CCTAGGGTACTTTAACTCTGAGCTATAGCCCCAGCCATTTCAAGACAGCTTACCATTCAG
TTGCTTTAGGTAGGGCCTTACTAAATGGTTGAGACTGGCCTTGAGCTTGCCACCCTCCTG
AGTCTAGGATGATTTTTAAAGGCAACTTCATTCCAGGAATGGTGGCTTATTCCTATAATC
CCAGTATCAGGAGACTAAGGCAGAAGATTTCACAAATTCAAGGCCTGCCTGAGCAAAATA
TTTAAAAAAGGTAGAACTACACCTGAGTAGTCAATTTAGTTTGTAATAGAATAGTTCCCT
AGTTCCAAGAAAAATGGAAGCATCAATCCTGCCAAAAGATCACCTGAGTAGCAGCATTTA
GAAGGGAAAATCAGTTGGAGGAGAAATCTAAAAGTAGTGCAAACAGTAAGGAACTGTTCA
GTGTTGACCGGATCCACAGGTCAATTTACAAAGGGGTCAGGTGGTACTGTTAGTGGACAG
TGCAAATGGTGGGAGTTAAGAATAATTATAAAAAATGGACCCATTGTGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved