Spermophilus_tridecemlineatus Locus Mono:128:SNORA42
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:128:SNORA42
Spermophilus_tridecemlineatus
Mono:128:SNORA42
GeneScaffold_5442
SNORA42
1001..1134
2134
GAAATTTGAAAATATCTGAATAAAAATCCAGAACCAAGCAAGAGAAGAGGTGGTAAACT
AGACACTCTGAAGAATTCCTGGTGGGACAAGATTAAAGACAAACATTAATGCCTAACAAT
GCTTCTTAAAAATGAAAGACAGAAAGGTGGTGGATACCAGAAGCAGCAGGGGATCCTGAG
GCAAACTCCAGCAGGATACACTGGACTCTTGCAATAGAAACATTTAAGCCAGTGTCCACG
TCTGCATCCTCATCTGGAATGCATAGTCAGGCACTGGGTGAGGGCCCTTGGGTCTGAGAA
ACTCAGCAGTAGCCAGAGTTGCTGATAACATCTAAGAACAGGGAGCCTCCAAGAGCAGAA
GATCAGCCCCTGGCACAACCACCTGGCAGCTCCTGCACCTCACCTTACAATAGCCATCTG
TTGTACAACTGAACCGAGCAGCACACCCCACCTCTCCTCCACTATTAGGTGGCAGTAAAA
CAACATTCCTGATCAGACTAACAGAGAATGTCAAAAATAAAAAATAAGCTTTCAGCTAAG
AATCACCACATATTTGAAGAATGCTAACACCAAGAAAGAGAGTTACCATGCAAATCAGGC
AATTCAGACCTTTCAGATACATGTAATTTATATTCTCTGAGAGATTTAAGAGGCTACCAT
CCATGGGGGGAAAAACAGCTAGATTTCCTAGAAATTAAAAAGCTTGATTATTAAATAAAA
AAGTCAATAGCTGAGCCAAATAGCAGGATAGACAAAAGTGAAGAATAAATTAAAACAGAA
CACTGAATTGAGGAATTATTTTAGAAATCAGTCCCAAAGGGTAAAAAGATGGAAAGTAGT
ATATATACACTATATTACACACACACACACACACATACACACACACGTAAAAATAATATG
GCAAATTTAGAAGTTCCAACATTCATGTAACAGGAATTCTACAAGGAGAGAATAGAGAGA
ACAAATCATAAAGACTACTCAAAGAAAAGAATAAAAGAGAATAATTTCTTAGAACTTAAG
AAACTCCTGTTCCCCTGGGCCTCCCATAGTGTCCCATGTCGGAGCAAACTGTGGCCCTGA
ATCACTGTCTGGAATCTGCCTTTAGGCTGCTGGCACTGCAGTGGGTTGCCCAGTAGGAAA
AAAAAAATTAAAAAGAAACATAAGTCTTTAGATTAAAGATATAAAAAGTATAGTGCAATA
CAAATAAAAAAGGACTGTATCCTAATAAAATTCCCCAATCCTGGGCTGGAATTGTAGTTC
AGCAATAGAGCACTCGCCTAGCATGTGGGAGGCCCTGGGTTTGATCCTCAGCACCACATA
AAAATAAATAAAATAAAGGTATTGTATCCAACTAAAACTAAAAAATAAATATTAAAAAAA
TTCCCCAATCCTCCTAGCCCTAAATCTGAAACGCAACCAAAGCAAAAGAAAAACCAACAA
AAACAGATCACCTTATAAAGGCGTAAGAATCAGATTGACTTCACATTTTAGCAGGTAATG
ATAAATACCAAAAATACAATAGCTAAAAAACATAAACAACCCAAATGTCCATCAACAGGT
GAATGGATAAACAAAATCTGGTATACAAATACAATGGAATATCAACTTTAAGAAGGAAGA
GAATTAATGCATCCTAGAACTAGGATGAACCTTGAAAATGTTATGTTAAATGAAATAAGC
TGGACACAAAAGGACAAATCTTGTTTGAGTCTACTTATATAAGATAGCAAGAACAGGCAA
ATTCACAGAATCAGAGGAGAGAGAGGAAGAAATGGAAGTTAAGATTTAATGGGTACACAG
TCTGTTTGGAATTATGAAAAAGTTCTACAAATGGATAGTGATGATACTTAGATAATAATT
TAAGTGTATTTAATGTCACTGCATTATACTCTCAAAAATAGTTAAAATGATAAATTTTAT
GACATATATATTTACCACAATTTTAAAAATTAAAAAAGTAAAATATCTAATTATCATAGA
AGAAATTAAAAGAACAAAGATCTGCATCTAAAATATGTAATACACTCAATGGGTTTACAG
GGATGATCTACCTAGATATCATGGGGACACTATCCACAATACATATTTAATTCCTATTAA
TCAACCAAGTATGGCGGTGTAAAAGCCTACAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved