Spermophilus_tridecemlineatus Locus Mono:155:SNORA16
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:155:SNORA16
Spermophilus_tridecemlineatus
Mono:155:SNORA16
GeneScaffold_5007
SNORA16
1001..1135
2135
ATGTGGGCGATCCGAGGCTCCGGGATCGAGAAGAAGGAACCGCTCGGGCCCGGCAGAAA
CCACACCCGGCCCGCCACGCGTATGGGGCTGCGCCTGGGCGCGTGGACTACAGGTCCCAG
CAGCCCCGCGCTGCGCTCAGCCCCTACGGCGCAGGCGTAATCGCAGACTGGGCATATATA
AGCCCGCTGCCGAGGCCCGTGCGTCCTTTCTCCTGTCCCTGGCGCTGGTGGTGTCTGGAC
GTGGAACCATGCGGCCGGTACCCGTAGCCGCCTTAGCTCGCTTCCATAGGCCCGCACTCA
TCCGGGCTGCCTCTAGAGACTGCGGGATGTAGAGTGCCAGGCCGGGCCTCTTGGCCTGGG
CTGCCGAGGCCCTGAAGGCCACGACGGCCGCCTGCGCAGTGAGACGGCACCCGCGGGGCG
GTGTCCTCTTCCCGTCTCCGCTGGCGCAGCGGTACCCTGGCGCCTGACCCGTGGATGAGG
CGAGCGGGTGGCCGGGTGCTGGAAACGAGTTGGGTATGTAATTAGGCACTTGGGGTTGAA
GTTTTGGGCCTCAGATCACCTAATTTAGGTAATAACATCAATCGGTGAGCCTGAGAACTG
CTGCGTGACATTGGACAATTGACTTAACTATAGAGTTTTCTAGAAGGTATCTTGGTGTGA
ATATAAGGACAAGATTTCAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCCCACATGCTAGGCAAGCACTCTGCCACGAGCACATCTCAACCCTTTAAAATGATTCT
GTGAGATTGAGATAATGCATACAAAAAGACTGGTACCCAGTACAGCCCTTAGGGCCTACT
GGATGACTAGTGTCCTTTGGTAGCCAATGATGCACAGGATTTAGATGAATTAGGAAGGAT
AAGTGTGGTTTGGCTTTGAGGTTCTGTGGTCTCCATTGCCCCCTGGCCCTTATCGAAGCT
GCAGCTGCTTCCACATAGCTTCTGTGGTCAAAAAGGAGCCCAGAGCAGCAGTTTTCCTTG
ACGGTCGCCGTTCTGTTTGCTGTAACTGATCTGCAACATTTTGGGAAAAGACAACTTCAT
TGTTCTTGCTATTTCTTAGGGATAGCTGGAGACCTTTATTAATATTGAACGTAGAGTTAT
CAGGATGAGGTGTTGAAAAATAACTAGTTGAGCCCAGGAACCAGAATGAAGGGGCATTTG
GGGGTGTGTGGGATACCTGTACTGGAAAGATCAGTGGCACAGAGAATGCAAGCGCTTTGG
TCTCTGTCCTGAAAAGCTATGTCATCAGTATCAGGATTAAAAGCCAGGCAGACCTTTATG
ATTGGATGAAGGAAATGCTAAGATCAATCAGGACAGTTGTGCTGTCTTTCATCTTAGCCA
TGCCAGATCAAGATGCTATGAAGATGGTGGCGAGTGAGGGTCATGGTGATGAAATGCAAC
AACTTCAGGACTTGGTAAGTTACTTTTGGAGCTACATGGGGAGCTCCCTGGTGGAACAGT
ACAGCATGTTTCCAAGGGCTGTGGCTGGTTGTGGCCATGGGATCTCCAACTGCATGCAAG
AACAACTGGAGAGACTTTGACAGCTCAGGTCAGCACAATACCTGCAGCTGCCACTCACCT
TTCCTATAAAGTCATCAGGACCTGGGTTGGAAGCCTGCCACACCAGGTCCAGGTGTGTTC
CGTCAACCACCATGTAGGTGGTTGTACTGGATCAACTGATTTAGAGCCTTCACAATAAGC
TTTGATTCTGCAGGTTGCCCCCAGGTTTCCAGGAAGTGTGTGATATTGAAGAGTGAAAAT
ACCAGCTTGTTTCTGGAGTTGTGCTTTAGATTAAGGTAAAGTTACCATGATAAAGTTACA
CTTGACCTTCGTCCCTTTCCCATCGGATCTGATACTGGTCTGGTGTCGTAAAGAGGAAAG
TATACTGAGCTGACTACCGTGTCTAGTCTGTTTTCTAACACATGGGCTAATTTCAAACAG
AAGTGAATTCTCTTTGAAATTGTTTGCTCTTCCCCTGTACAATGGAGGATAGAGGATGAG
TGTGATGCTGTGTGCATTTGATTAGGAATTGCTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved