Spermophilus_tridecemlineatus Locus Mono:180:SNORD22
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:180:SNORD22
Spermophilus_tridecemlineatus
Mono:180:SNORD22
GeneScaffold_5272
SNORD22
1001..1119
2119
AGATGAGGTGTCCTTCAAAGATGGAGATGCTATTGTAAATGTTCAAGCTATTGATGAAG
GATGGATGTATGGCACTGTACAAAGAACTGGAAGAACCGGCATGCTCCCAGCCAACTACG
TTGAAGCTATTTAGGCACTTCAAAAACTCACATCTGTAAGACCTACAACTCCTGCAGTGT
TCTAGTTTAGACTCAACACTATTGCTTCTCAAGTTAATGTTTTTTTGCCAATGTCATTTG
TGGCAGTAACATCTCAATATAATTTATTTGTATATGAACTCCAATAATTCTCCATTAAAC
CAAATATTCATGTTAATCTGTCCAGTTTTTAAACTAGACTTACATTTTCATTATTTTCTG
GACCTGCACATAAAACTTCAGACAACATTAAGTCTGTTAAGTTCTTTATATTAAACAATG
CCATTATCAAATTTCTTTTGGGATTTAAAATCAGTTGAATTTCAGAATAGACATTTTAAA
AACTCCTGCTGTGTTATGTTATTACTGTGTCAACCCAGAGTCTTTCCCAATTATAAAAAA
AGAGAACATTATTTCTTAAAAAGAGGCATTCTGGGGCTGGGGTAACTCAGTAGGAGAGCA
ATTGCCTAGCACATGCGAGGTGCTGGGTTTCATTCTCAGCGCCACATAAAAATAAATAAA
AGTATTGTGTCCAACTACAAGTTTTTTTTAAAAAAAGGCACTCTGAACATGACAAATACA
CTAAAGGAAAAATGGCAGATATTCATATTTCCCTTCCTTGCTTTTAAATGCTAATGCTTG
TGTTCCTAACCCATTTCTAAAATTATAAATCTGGTAGTGAATATAAACTGGTGATAAACT
GGTAACTAATAAAATTGTTTTCTGCAACACTCTGCTGATGGAATAAACTTTATTTTTAAT
GGCTTCAATGTACTATTAAAATGCATAAGAGTAGTCATTCTCAATACTGTACATAATGTG
TTCAGCAAACTTCCTTGAAGAAATAGATGTAGCTATAGGATTCCCAATGAAGAAACATTC
ACGTCTTACTTCCTTTCTGGTCCCAGAATTGGTAAAGGTGAATCCACTAGGGCTGGCTGT
GAGAGAAGAGCAAAATTTGTTCCAGAAAGAACTAAGGAATCATCAGTATTTCTGTACATG
GAAAAGGGAAAAATTATCCCTTGTTTGAAACATAGTTTGCTAATTTTTTTTCTAGGTCTG
AGAAAGAACAAGGTGCACTTAAATGAGGTCCAAGTCTTGGAGGACATCAGGGACTTTTCA
GGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved