Spermophilus_tridecemlineatus Locus Mono:20:SNORA2
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:20:SNORA2
Spermophilus_tridecemlineatus
Mono:20:SNORA2
scaffold_84421
SNORA2
1001..1136
2053
TGCCTCAGCCTCCTGCTTAGCTAGAATTACAGATGTGCACCACTGTGCATGGTCCTTCT
TTGTATTTTTTTTTTTTAATTCCTCTCAATAGTGGATTTTTGTCTCCAGTGGCTCAATAG
TAGTAAGCAGATTTATGGAGAATCACAGTGGTGTTTTGCCAAGTGACTAGTAACCAGCCC
TTCCGGTACCTTTTTCATCATAAACCTGAGGTAGGGTGGGGTCAAGGACCAAAATGGAAT
GCTTCCCTGAAACTAGTACAGAGTTGCTCAGAAAAATTTTCTGTAACCCAGTGTGATGAT
TCAGCTTTGTATTTTAGCAATAATTGACTGGGTTGTCTCTACTTTGGCATTTGGCTTGAC
TGGTTCAGCTGTTCTGAAATTACTTCAGTAACATTCATGATTTCCCAACTTTTTTTCATA
ATTTATAGGCTGTTTCCCCCCTACCATGTCTTGGCATCTATGAGATATGCCAGAATTGGG
TATCTCTGTTTTAAATAAGTCATTTGATATTTGAGGAATATGGTTCCCTTTTTCAAAGTG
AACCTCTTATATGGGTTAATGTACTTTTATTCAAGTTGTAGTAGTATGTACCAAAGTAAT
ATATAGTTGAGAAAAACTACATAAAGGAGGGGCCGGGTTGTGGCTCATTGGGCAGAGCAC
TTGCCTAGCATGCTTGAGGCACTGAGTTCAATCCCTGCCACCACATAAAAATACACAAAT
AAAATAGATGTTAAAATAAAAAAAAACTACATGTAGGAATTAGGGTTATTTTTAGCTTGG
GATTGTCAACAGCATTCTAGGCATTTATTTTTATTTAAATTTTTTTCTTCTAGCTTTTCT
TTGCCAGCAGTATAACATGATCCCATAAGCTTGAGTTATGTGTATGTGAGGGGTGGGGTG
GGGGCAGGCTGTTGAGTAGTGGCATACTGGGAATTATGGGTTATAAAGCAAAGCGAGGTT
TCAAGCAGGAGCCTAAAGAAATGTCTTTCTATGGTCTGTTGGCTGTTTCAGAACTTTAGA
AGTATAATAGTCAATTCAATAGAAAGAAACATCTGAAGGGGGGAAAGAAAAAAAAAGCCA
ATAAAAACATTTGCTGGAAAAAAAAGCAAAGAGAATAACAATACACATTCTTGTTGATGT
TCTTTAATTGTTTAATTATGTAATGTACATAATAAATTTTTTTTGTTACAGTTTATGTAG
TTAAAGAAAAATAGAAACTTAAAAAATCTGATCCCCAAAAAAGAGATGTTGTATTTTAAT
ATTTTGGTATGTATTTTTCTGGGCGTTTTATACATGTGTAAGTGTATGTAAATTTATAGA
TAAATATTTTATGAAAAATTATATCAGGGTCTGGAAATGTACTTCAGTGATAGAGTGCAT
GACTAGCATGCACAAGATGCTGTTTGGTCTCTAGCACCAATAAAGAGAAAGAAAAAGATA
CTATACTATATTTTAAAAAACTTTTTTACTCAACAATTTATTATGATACCATAAATACAC
ATCAAAATTATAGTTTATAATATTTTGTTAAACTATATTTTAATTGATGATACCTATCTC
CTTGTTCATATAGGTTTTTTCCAGTTATGGTACTTAGACATTCATAGTTATTATATATAG
TGCTATAGTAAACATCCTTTATATATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved