Spermophilus_tridecemlineatus Locus Mono:118:SNORA18
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:118:SNORA18
Spermophilus_tridecemlineatus
Mono:118:SNORA18
GeneScaffold_1841
SNORA18
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTGAGCAGTCCATGCTTGGTCAGACAGCAGCAGCATCCGTC
AGTCCAGCTTCTGACTGGCTGCCAGTCCAGGTTCTTACTCTCCCCTTTCCTCAGTCCTCC
CACTCAGCTGTGATTCCTGCAGATTGTACCTCCTGGGGCTACTGTAGTAGAGCCCAGTCA
CGTTAAGTTCCCTGGCTTAATGGCCACTGCATCAGCCACTGGGATGACAAAGGTGCTCTC
TGGAATGCCCAGGGGAAGAAGGGTCAGTTGTGGGTGGTGGACCACAGGCCATCTCTGCTT
TCTTTTTGTTCCATCTATAATTGGCACTTTAAAAAATAAACATCGAGTTGAAGTCTGTCT
TCTCCTGCAGCCACTCATTGTTGGAAACGCCTCATAGGGCAATTCTGTGGTTTTGTTTTA
CTCATAGGACTGTTTGTTAGGCCTATGGGAAGGAACTACAAGACAATTAAAAAGTATGAA
AGACCTAACTTTTTTTCTTCTCTGGGTATTGGCATATCCCACATCTGCACGACTGGGTGT
GATGATAGGAACACATATGACTTGAACTCACTGATATTTAGAGAAGGTGTCAGCCCTTGA
GAACCAGGCATATCCATCTATACCCCAAACTATAAGGCTTTGTGCACATTGCTTCTGGAT
GTTTGTTTTTCTCCTATTTGGATCCTTGAAAGCAGCTTTGAAGAAATTAAATCCCAAATA
TGCTAGGTGGAGTATCGCCATCTATCGGAGCTGGCGACCTGTGCTGGGTTCACAAATCTG
ACTATTCCAGTAACTTAAGAAAACAGCAAAGAAAGCACGCAACACACAGAAGTACCTTTT
CAAAATTCAGGGACAGCTCTGCTACCTTAGGGGTCCATGGAAAGAGAGAGCCACTGGAAT
TCTTTATTCTTGTATAGGGGACACACAAGGGGAGGTTCCATGGAATATTCTATCCCAAAA
AGGACAAAGGGGTAGGATTACAAAGGAACAGGTGAGTGTAACTCAACCCCATCAGGTGAT
GCCCACACCTTCCTTATCCGAGCTAGGGAAAAGCCCAATGTATTGCAGGGTGCGATACCT
GTTCAGCACCCCTTTACTCAGGACTTACAGGTGTGCATATAGCTTTTGACCACAGCAACT
CCCGACAATGGCGAATTGTGAAATCATCGCTGTTCCATAATTCAAGTGGGAAAAGAATGG
TGGGCCTCGGGCTCTCTGCTGGACCTAAGGCTCTCTGCTGGGCCTAAGGCTCTCTGCTGG
GCCTAAGGCTCTCTGCTGGGCTCAGGTTCTCTTCTGGGCCTCAGGCTCTCTTCTGGGCAC
AGGCTCTCTGCTGGGCACAAGCTCTCTGCTGGGCCTCAGGCTCTCTGCTGGGCCTCAGGC
TCTCTGCTGGGTGCAGGCCCTCTGCTGGTCACAGGCCCTCTGCTGGTCACAGGCCCTCTG
CTGGGCCCAGTCTCTCTGCTAGGCCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved