Spermophilus_tridecemlineatus Locus Mono:157:SNORA14
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:157:SNORA14
Spermophilus_tridecemlineatus
Mono:157:SNORA14
GeneScaffold_5505
SNORA14
1001..1133
2133
CTCCACGGTGCCTCGGCCTGGCTCATAGGGTGCTGGGACAGTCCTCTGTAGACTGCTAT
GCCTCAGACCCGGCCACGAGCCTGGGGACCTGGCACCTGGTGTTACCTATTACCTTCTCT
GGTCCAATGCACTGAAAGGGCTGTAAAATCAGATTGCAAACCTAGGCGCTAGTCAGAGCC
GGCCATTGGAGAGGCGGATGTTCCATGCATGTTCTACGGAGTTGCCCCTATTTTTCTCGA
ACATCTCATGACACCTATTGCAACATATATTATTTTTAATATTTATTTTCTAGTTCTAGG
TGGACACAATATCTTTATTTTATTTCTATATGGCGCTGAGGATTGAACCCAGTGCCTCAT
GCATGCTAGGTGAGCACTCCACCACTGAGCCACAACCCCAGCCCGCAACATCCTTTTATA
AGTGAATTACTGTGCCCAACTCGATCAGGACTGGATTTGCAAGGAAAGTACACGTCACAG
ACCGCTGGAATCAACTGCAAGACAAAGCTCAGTATGCACTGGCCTTCTACCTTTGTTCTT
GCCTGCAAAGATCCCTAGCGCCCGACGCTCCGCTGCGCTCGCTGGGGTCGCAGGCTGTGC
GTGCGTGCGTGCGTGCATGCGTGTTAGCGCACTCCGCCGCGCAGGCACCAACGCGAGCGC
CCCGGGGTCCTCGGAGCCGGAAGCGCCTGTTCCTCCTTCCGGCGTCCAGAGCGACGGGCG
GCGAGGCTCGTTTCGAGTGCTCGCGGCGGCTTCGCCGCACTGGGGAAAGATGGTGGGCCG
GAACAGCGCCATCGCGCCGGCGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGCACCGTTCTAAGCCTCGGTCCTTAACCCGAAGGTGGAGCTCCCTACTAGAC
AGAGTTCAGCCCGTGCGGAACCTGCATGCCCACTGCGGGCGTTGCATTCTTAAACCCTCT
TGGCGGCTTCGCCTAGTGCTTCCAAGATATGAGTGAATGCTAGAGAAATTGCGGGGGAGT
CCAAAGGGCTGCGCCTCTCTCGTGGCTCAGCCTCATTTCATACCTGCGACATCTTTTAAG
AGCCGCTTCCCGAGGGAAGATGTCATGTCCCCAGAAACGTTCGTAGGCCGCCTTGCGTTT
CGGGGGGAACTTTGTTCGCAGCAGTAGAAAAGCAGATTTGTTTTAATAAGAAATATTTTG
GTAATCTGTCCAGGTGGCTCAGCCATGAGGGTTGTTAAAGCTGCGGTCGCACGAAGAAGT
GGCCGCTCTGCTTGGTACTGGGTGGTTAATTCGGCAGTACCAGGTCGCCGCACGTGGTCC
GTAGCCGCACGCGGCTCGCATTCTGGAGCGCGCTGGTCGTAGACCTGCCTTGCAGCACGG
ACTGGCTCCAGGCTTTAGTGGGGAGTGAAACTAAGGATTTGGTCCATTTACCGCTAGGTA
GTCTCACGGAAAGAGCGATATTCTGGACTCAAACACTGAGTTTCCAGGCCCGGGTTGGTC
ACTGATGAGCAACATGATCTTGGGCTTTCTACATCTTAATTTCCTTAGCTGTGAAATCAG
GTAATGCGGCTTGCCTCTTGTTGGTTTGGGGGAAAATAAAGTGTGAAGTGCTCACCATGA
TTTATGATGTAAATGCTGACCCTTAAGGATGATTGTTGGAATACAGGTCTATGGTTTCAA
AAATGTATTGAGGGTGGAGGTGCAGGTGCAGAGTTCCATAAAAGTAGATTAATTATACCT
TTGGAAGATTTGAAGATCTGTTTTAAAAGGCTTTCTTCCTCCCCTAAGTACTGAGGTTGG
TAGGGAAGTCCTCTACTACTGACCTATACCCCCAACCTTTTTTATTTTGAGGCAGAGTCT
AAAGTTGCCTAGGCTGGCCTCCATCTTGCCATAGTACAGGCAAGTGTCACCATACCAAGC
AAGAAAACTGGTTTTTGGTTAAAGAAATCATAAGAGCTATCATTTTAGACGAATTGAGAA
AGTTATTCTCAGAGTGCCTTTTCCATCACTTTCAGTCCAAATATTTTTTTAGCTTTAGCT
GTGATATGATCATTTTAAGTGGATTACTAGCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved