Spermophilus_tridecemlineatus Locus Mono:129:SNORA27
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:129:SNORA27
Spermophilus_tridecemlineatus
Mono:129:SNORA27
GeneScaffold_477
SNORA27
1001..1131
2131
TTATAGTTTGGGGGTTTACATTTAGCACTAGGAGGCAATTGGAGTTATATCTTGTATAT
GGTGTGCTGGAGATTGAAGTTTATTGTTTTGCAGATGATATCTAGCTGGTGGGAAAGTAT
TCTTTTTCTACTGATTTGCATTGATATCTTTGTCAGTAATTAAATGTCTGCCTAGGGGTG
GGTCTGTTTTTTGGATTCACTGTTCTGAACCATTGATCTACTTATCCATTTTCATGTCAA
TGCCACACTGTCCTGATAATTGTCATTTTTCAGGGTTTTTTTAATATTTATTTTTTAGTT
GTAGTTGGACACAATATCTTTATTTTATTTATTTATTTTTATGTGGTGCTGAGGATCGAA
CCCAGGGCCTCACACGTGCTAGGCGAGCGCTCTATCGCTGAGCCACAATCCCAGCCCTGA
TAATTGTCATTTGATCACAGGTTCTGAAAACATGCGGTGTTCTCCATCTTCGTCCTTTTT
CTAAGCCATTTTCACTCTTCTGTCTTGCATTTTAGAACCAGCTTAAGTTCTGCTTTTAAA
GTACTGTTAGAAATCGGATAGGTCTGCATTCAACTTATAGATTAATTAATTAATTAATTT
TGGGGGGTACCAGGTATTAAACCCAGGGGTGCTTTACCACTGAGCTACATCCCTTGCCCT
TTTTATGTTTTATCTTGGGACAGGGTCTCACAAAGTTCCTTAGGGCCTCTCTGAATTGCT
GAGGCTGGTCTAGAACTTGAGATCCTCCTGCCTCAGCCCCCTGAGTTGCTGGGATCACAG
GTGTGTGCCACCAGGCCCAGCTGAACCGATAGATTAATTTGGAGAAAGTTTGTGTGTCAT
GAAAGCAGGCTCTCCCTTCATATCTATAGATCCTCTTTAATTTCTCTGAGCAATATTTTT
CAGTTTTCTGTGTACTATGTCTCGTCATCTTTTGTCCTCTATCCCTAGGCCTTTCATGTA
TTTTGTGATTATAAGTGGTGTCTCAAAAACTTCAATTTTGGTGTCTCTCTTTCACTTTGC
TCAAATGGACTGATGTCTTTATTGGTCATTCAAGTGGGGCAAAGGAAATGTTCTTCTTAA
AACTCAGGCAGATGAAGTGTTTGCTCACGTAACCTGTCAGATTGAAGTAGATTTCCTGGA
AGGTCTTACACAATTTGATATTAAAGCAGTTCTAGTTTTATAGCATAAAAAGTGAATGAA
GTCTTAAATTATACTAGCGATTTGATTTGGATTGTCTAGTGCATCAGAGGTGTCATCTCA
TCAGAGAATAGCTGTAAAGTAGGGTGTAGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved