Spermophilus_tridecemlineatus Locus Mono:177:SNORA26
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:177:SNORA26
Spermophilus_tridecemlineatus
Mono:177:SNORA26
GeneScaffold_4811
SNORA26
1001..1109
2109
AATCATGGGAGGAAACAAGATCACTTAAAGCAAAGCGCTTGAGTCATCTAAGAGAGGTA
ACAAAAAAAACGGGTTTTTTTTACTAGGAATGCAGGGAGGAAACGCTGAACATCACCAAC
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAAGGCCCCAGACGAG
CCTTGGCAAGCTGCCACTTTTGTCCTTTGCATTGCGTCGTTCCAAATATTCTGCCGTTGT
CGGAGCATTTCCCCCCCTCAGAGGCACGTTGGCAACAATCATAAGCTTATTATTAAATTG
TTATTAATTCATCATGGAATTTTTCTTAAAAGCCACACTGCTTAAATTAATCACATCAAC
CATTATTCCTTTTCAGTCTCTGAATCCCATCTACTAGCTGAAAGGACAAGTCAGGTAATC
AGAACAGTAATAACGGTCCTTACCGATGGCCATTTCTCCCAGTGCGAGGGGTGACTATCC
TTCAGCCATACCTGGTCCCGAGCTGATGGAATTAAATCATGTGCATGGTTTAAGTTTTGG
CACAGATGGTCCTAGATGTTGTTTGTTCTAAGTGAGCGTTTTTCAATATGCGCATTCACA
AGTCCTCCAGATAAAGTTCTCCAAAACAGAGGATATTAGTCAGGGTTCTTTGGTTGTAAG
TGACAGAAACTCGACTAGAACTAACCTGGATCAAAAGCTGGGGATGGAAAGGGGGCTCAT
ATCATGTTGGCAAGGACATGGAGCAACTAGAGCCCTCATTAGTGACACAGCCAGCACTGA
GGGAAGGAAGGAAGCTGGGAGTCCCTTAAACAGTTCAGCATACACTCAACCAGCCTTTCC
ACCTCTAGGTATTTACCTGGGAGAAATGAAAGCCTACGTTCTGCAAAGACTCGTGCCCAG
AGAGTCATGACCTCATTGTTCATAATAGTCAAGAACAAGAAAAAAATGATGCAGGAATTT
AAGAGGCTCACACAGAAGGGCAAAGGAAACCTTCACGGAACCCAGAGAAGAGACTTAAAA
ACTCTCTATATCCTGTCTGGAGTTACAGTTGAAAAAAAAAAAAAACTGGAAAAAATAAAT
AAATATCCAACAACAGATGAGTGGATAAAGAATGGAATACTTTCTCAGGAAGAAAAAAAT
AATAAACTATTGATGCAAGGTACGACATGAATGAATCTCAGATTTATTACAGTGACTGAA
AGAAGTCAGACCCCCCCCAAAAAAAAGAGTAATATTGTGTGATTTTATTTATATACAATA
AAAACTACTTGACAATGACAGAAAGCAAACCAGTGGTGGCCTGATTTGTCCCTGGGTTGA
GGGACAAGAAAAGGTGACAAAGGTGCCTGAGGAAACTTTGGTGTGTCTCAAACACATTTG
TTATCTTGGTTGTGATTCAATGAATATAAATTTCTCAAATTGTACATGCAAAATATGCAT
TAGTTATGTATCAGTCATACCATATGAAAGCTGGAAAAGAGGGCAGAAGATACTAGGTCA
CAGAACACAGATGCTCTGTGTATCAAACAGCAGATGAAACCAGGGATAAGCAGAAACAGG
GATTCTGAAGCCATCTGACACACCGTTTCTCAGCTCTCCTCGAGCTCCTGGATGTCCCTA
TGATGTGGCCCCCTACTGCACACAATGCGGGACTTGGTGACTGGCAGCTCTGAATGAACT
CCTCCAGACTCAGAAATCAAACAAGAGTCTTCCCTCTCCCAGCTCCAGTTTGAAAACACC
CCAAAGGTGGACTCTGTGTGGCCAACTCCCCTCGTGTGCTCTTCCTCCCAAGGATGACTG
GGGAGAGGGGAAGGAGAGTTATGCTTGGCCCCGGTGGGATGCTGTTCACCCCGAAGGTGG
CTGGTAGGGTCTATTGCCAAAACAGAGGCTCAAATATAGTCACCAAAGAGAATCACGGCA
AGCCAAGAAGATATTCCAATCTTTGTCTATTCTACCCTCTTTAAAATGGCTACAATATAT
GCATTTAAATACATGCAATTTTATTGATTCATTTGCACCAACTTATATGAATTATAAAAA
GAGAGACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved