Spermophilus_tridecemlineatus Locus Mono:29:SNORD96
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:29:SNORD96
Spermophilus_tridecemlineatus
Mono:29:SNORD96
scaffold_158260
SNORD96
1001..1077
2077
TAAGTCCAAAGGACAGAGAACAGGGGGCAGTCACTGCTGCTGGAAGTGTTTACTCAAGT
AAGTAGAACTTTCACATTATAGTCAGCCCTCTCAATCTGCTGGTTCTGCAACCATGATTC
TATCACTGTGGATCAAAAAATATTTGGGAAAAAAAGTTTTTGTATAGAGCATGTACAGAC
TTTGTTTTTGTTGCCCTCATTCCCTAAACCATAAAGTTTAGAGTGTAACAATGATTTGTA
TCACATTTACATCATAATAGGTATTATAAGTAATCTCAAGATGTTTATATATGTATACAT
GTGGTATATATATATGCATTTGTATATAAAAGAGTGTGCATAGGTTTATGTGCAAATATT
ATGTCATTTTTATATAGAAGACTCGAGCATCTTCAGATTGAGTATCTGAAGAGGGTCCTG
GAACAAATCCCCCTAGGATACCAAGGGATGATTGCATTAATTGCTTGTATCAATGATACA
TAATAAAGAGGTTGTTTTTGTTTTTTGTTTGAGAGAGGCTACATGCCCATATATGTCATT
GAGACAGAGGCCACAGTCTTGTCCAGTGATTGGAAGAAGCCCAAGTGAAATCGCTGTTTT
AAATGGAGTCTGGTTTAAACAGCAAGAATAGTTATCCTTAATAATGGAAATAATTCCAGG
AATAATTTGGTTAATGGTATACTGTTGAACACTTGACATATACTTTAATAATATATACAG
TAGCAGAATTGCAAATTTTGAAAAGTGCTGCATAGAATCAGAAAGAACACAATAGCACTC
ATGTCATTATTTTGAAACTATAAAAATGCCCCCTAGGACATAAATTATTTTGAGTGAATA
GAAATATCAAAATGATGAGGAGAAAAGAATCTCCAAAGGTAAATACTTACAGCAACATCT
CTTGAGAGAATTATTTTCGTATCTACTCGAAGATACAGATTAATGTATTTTTTATTGGTG
AATTAGAGATGCAAAAGAAGGGGAGTTTCCACTCATTTCATTCAATTATTTGAGGAAAAC
AAAAATAACATCTTTGGGGACTGAATAATTTGATGATAATAAAGGCAATCTCAATTGACT
GTTCACAACCATATTCATTTCATATCCATTAAAGACAAATTATACCATCCCATTTAGCAG
AAAAATTAAGATTTGGAAATGCTTTCAGAAAAATAGCAGCTCTTATGTGTGGCCTCTTTT
CTTCAAGTACAATCAACTGCATCTGTTCATGGAAGAAACAACAAATATGTGAAATAATTT
TAAGGTAATAATAATAAAGGTTAAAATACAAAACACAAATTCCTTTCTTTTGGACATGGG
TATCCAACACTCCATTTTAAAAGGAAACGTTCACATGGGACATTATTTTTGAGATCCTGT
TTATAAAAAAAAGTTTAAATATGTCTATAAATTAGATACTTGGAACCATAACTATTTTTA
TAACAACATGAGAAAGCAAAAGTCTGTCACAAATTAAAATCAAACTTGAGATTCTATTTT
TGAAAACTGAGAGTACTTTCTTTTCTCTTGTTTCTTGTTTAAAACATCTCTATGGGGAAC
ATTTTAATGAAACAACGTACTTATTCTCCTGGCTGACATTACATAAAGATGCTGTTAGAA
TATAAGTGGTTAAAAGTAGAGACTTCTCAGTTGAATGAAATCACCTTTGCCTCCCTTTTG
GCTGTGATCCTTGCCAAGTTTCTTTACCTCTCTGAACCAACATTTTTGTGGCATCTCTTT
CAGATGCCATAGTTCACTCACTGGTCAGCACTTATAACTAGTCAAATTTTTGATATTGTG
AGCTCATTAAGATGCTTCAAATTTACCTCTAAATGATCCACCTAACCAAACTACAAGCAC
TCATTTCTTACATACAAAATATAGTTTACAAGTTAATGGCCCTTCAATGCTGTTACATGC
TCTACTGGCTATAGCTTCTGGTAGAGTGCTTACTAGCATGTGTGAGGCACTGGGTTCATC
TTTCAGCACCACATAATAAATAAATAAATAAATTAAAGTATTAGGGTAATCAATGACAAC
AAATATTTTTAAAAATTCCACTTTGATGATTTTTNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved