Spermophilus_tridecemlineatus Locus Mono:97:SNORD64
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:97:SNORD64
Spermophilus_tridecemlineatus
Mono:97:SNORD64
scaffold_141297
SNORD64
1001..1067
2067
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCATGATAAATAAGAATATTCGGGGAGAACAGACAG
TGTTAGTACTGTATCCGTCTGTGTTGACATTTGAATATCCTATTTCAGTTTATAGGACAA
TTTGCTTATGGAAGTTGATTATAAAACACTAGATTTAGAATTGAGCATGGTGATACACAC
CTGTAATCCCAGGTACTCAGGAGGCCCAAAGCAGGAGGATTATGAATTCAAGGCTAGCCT
CAGCAATTTGGCAGGACCCTATCTCAAAATAAAAAGGAAAAAATGGTCAGGATATTGTTC
AGTGATAAAGCACCCATGTATTCTCTCTCCAGTACTGGGGTTGTAATGTTGGGAGAAGAG
AAAGTGAACTTAGTTATATAAAACAAAAGATCTCAATCTTAAGGTACATTGTTTTGTTTG
TGCATATTTGTGTCAGTATGTCTCTCTGCCTGTATGCCTGCTGATTTTTTTTGTTTCTTA
CTATTGTCCCCTTAATTCTGCATCAGTCTATTACATTGTTTTCATATCCTTTGCCAATTA
AAGGCAATCATTTTACCAGATAAGAGGACTGTCTATGCATAGAGATATACTTTCTATATG
TTAAATTTTTTTTTGATTTTTTTTTTTTGGTGCTAGGGTTTGAACATGGGATGTATTAAA
TGCTACTATGCATTATAGCCCTGGCCTACAACCCCAGTCCCATTCTTTTTATTTCTTTTT
AAAGTTAGATTTTAAGAGAGACTTTGGTAAAGACCTTGGCTGGATTTATGATGAGCTATG
TTTACTGAGCATGATGAAGTGAAGCTCAATATGATTACTCTGAGGTCCAGCCTAAGTGTC
ATTTTTAAGGATTTAGGACAGAAATATTCTGAATGTAAGTTTTCAAAATGTAAATTTCAC
AAGGTTTTTCTTATCAATACTTTCTGGTAAAGGAGAATGGACTGGACTGGTAGATTTCCT
TTTTTGCAGTTCAGTAGACAAAAGTGGTTATATTAGTATAGTTTTCTTTTGTAGAGTGCT
TCTATATTCATAGTCTTGATAAATTTCAAATTTCTCCTTTCCATTATGTGTTTCAAGTGA
TAAATTGAGGAGAATAAGGACTTGGAAGGTACTATGTATCCCTATCCCATTACTAGCATC
ACTTAGGTTCAAACGTCTGTGAACATTTCATAAGCGTTTTTCTAGTAACTGAAGTAGTTT
CTATATTTACAAGTTCAATAGGAAATTGATGGTTTATTATGTATAGTTTAAGATTATGTA
TAGTTTAAGTTAATTTATAGCTTTTGCACATGCTTAAGTTATATACAGAGTTAATTTGGG
GTTTGAACTTAAGGACTTGGACATGTGACCAAGGGCTAACTGAGCTGTATCCTCAGCGAT
CTGGTTTTACTTTTAATGTCTTTTTCTGTATCTTGGCAGTATGAAATCTTAGAAGTTTGG
ACTGTGATGTAGTTAAGGGAATGAAATTGATATTTTGTTGGTGATGCTGGTCACACAAGA
TAAAGATTTGCTAAATATTAATTTCTTGAGTTATGTATTTTATCTCATTGTATCCTTTTA
TATTTACTTGTTTTATGATATTGGGTACTGAGCCCAGATAGACATTATTTTGTGTACTAC
TTGCATACTTTAATTATACTGATGCTTGAATTGTTTGATTATTGGCCATTAGATGATCTT
TCAATTAATTCCTGTGTCCTTTTTGTGAGAAAGGCGGCGAGATTCACCTCTAAGGGGGTT
GCCCAATAAACTATATCACGAGCCGTTGTACTTACTATAAAGTGAGAGAGTTTGGCTGAG
TCTCAAAGGTTTTTCTCCTTTCTTAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved