Spermophilus_tridecemlineatus Locus Mono:5:SNORA73
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:5:SNORA73
Spermophilus_tridecemlineatus
Mono:5:SNORA73
scaffold_117416
SNORA73
1001..1203
2203
GCAGAGGCAAAGTCAAAACAAAGAATAGCTTAAACTGCTGTGATGAGAGGTCTTTGTTC
TTGCTCTCTGTGAGGATTTCATATTGCTCTGGACCAGGGATGCTAAGAAGCTCTCAATCT
TCTCTTCTACAAATGAAATTTTCATTGGACTGTATAGCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGAGTTCTTCA
TCAGCAGAGACCAAGTTTCTAGTTATTGGGAATTTATCCAAGATGCTTTGCTCTCTTGCA
TCTTCTTTCTTTTCAAAGTTCAGGGTAGTGTGGGTGAGGAGGTGAAGTAGAAGGAGGTGA
TCTGAGTGTAGATCTGGAGTGGACAAGTAGGTGATTGCAAAGAAGGAGAAGTGGAGTCGT
TTTCAGGTGATGACTAGCTGGTGGTTGAACTAGGAGAGGTGAGCTCTGCTAATTCCCTGT
TTAGTGATCATTCAGTTTGACTGGTCTTCTTCTCAATATAAGAAGTCACTTAAATCACAC
ATTAGGAACAAGTAAGTTGCTTTAATGAGAAGCTTATCCCATTCACATGGCTAGTCCTCA
GAGGTCTCTTTCCCCGGGATCTTTGTCCAAGTGGCAAAGGGGAGCATACGGTCCTTTCTC
AAGATGGACAGTCTCTTTCCACAAGGTTGAAGAAGCAGCTGGGCCTCGAGTCTACACCTG
CATCTTTTTACAACTTCTGAGTCTTGGGGACAATGATTGAGGGGACAAACTACAGGAAAC
AAAGTTAAAAAAAAAAAAGAAGCTTATTCTTAGAAGAAATTAAAACTATTGATAACAATG
TCTCAGATTCCTTTAAGCAACCATCATCTTGCTATATATAGCTTCATGAATGATTAAACA
GAAGGTGACTGGGGCCAAGAATAAGTACTCACTCTTTACTCATTATGGAATTTATTATTT
TCTAAAAAAGTGTTTTCCAATTTCTATCATTAATATTTAATTTTTTAACCTCATTATTTT
TGTAAGCCTAAATAAATATTTTAAGTGTTCCCTCTGCTTTGTCCTCTTAGAATTCTCAGC
AGATGGCCCTGGTATATTAACAAGGTTTCTTGAGAATATCAGACATGAACTTTTTAAAAT
CCTGACTCCTCCAAAATTGTTTATACTCCTCCTTTTCTTACCTAATTTCAGAAGAATAGA
AATTATTTTTCCTACAGAACTCTAAATTCTACATCTGTGCACATTGTTCCATTTCTATAT
AGGTTTTCCTAAACACTGTACCATCAAATAACTTCAAATAGTCTCTGATTTTTTTTTTTA
TGTTTAAATTCTCATCTTGCCCTTGTCTCTTTAAAAACCAAAGGGGACACACCCAAAAAA
TGGGAAAGAAAACCTGTGATCATGGATTGGGAGGATCATTATGGTCAAGGTATCTACACC
TCTCACAGTGATCTACAGATTTAGTATAATCTCCTATCAAAGTACCAACGATATCCTTCA
TGGGATTAGGAAAAAAAATCCTGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGTAATGGTGCTGGGGCAATTGGGTGTCCACATGCAGAAGAAGGATAACTAGAC
CCTTATTTCTCTCCAGTTTCAAAAGGCAACTCAAAATGTATTAAAAACTTAAGTGTAACA
TCTGAAAGTATGAACTACTGGGATAAAACACATGGGAAATACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved