Spermophilus_tridecemlineatus Locus Mono:196:SNORA40
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:196:SNORA40
Spermophilus_tridecemlineatus
Mono:196:SNORA40
GeneScaffold_4140
SNORA40
1001..1113
2113
TGTTCTAAGGTTTCCAGTTTCTTGTTTGTTTTTTTTTTAATATTTATTTTCAGTGGATC
TTTGTTTTATTTATTCATATGTGGTGCTGAGGATCAAACCCAGTGCCTCACACATGCTAG
GCAAGTGCTCTACTACTGAGCCACAATCCCGGCCCCAGTTTCTAGCTTCTTTACTGAGCA
GTTACCTCCATGTCCAGTTTCTCAGCTCTCCAGTCTGCAGATGGCCATTGTGGTACTATC
CAGCTTGTGATCGTGTAAAGCAATCTAATAAATCTCCTTTTACAAATATAGGTACAGATA
TCTAATAGTATATCTATTCCTCTAAAGTATAACTATAAAATAATAAAGCCTGGGCTGGGG
CTGGGGCTCAGCGGCTATTCGCTCTTGCCTGGCATGTGTGAGGCACTACCTGGCATGTGT
TCAGCACCACGTGAAATAAATTAAGGACTATCAACAGCTAATAATAATAATAATAATAAA
ACCTAAGCCAGGTAAGGTGGTGCACACCTAAAATCCCAGCAGCTCAGGAGGCTGAGGCAG
GAGTACTGTGAGTTCAAAGCCAGCCTCAGTAAAAGTGAGGTGCTAAGCAACTCAGTGAGA
CTCTGTCTCTAAATAAAATACAAAATAGGAATGGGGATGTGGCTCAGTGGTTGAGTGGCC
CTGGATTCAATCCCCATCACCACGCCCCCCCCAAAATAATAATAATAAAACTTAAACCCA
GTTCAACTCTTAACTAAATTACCTCAGTTGTTCACAAAGCCTATGAGACATGCCCATTTC
TAGACATAAATACTATCACAGTATCTGGTCTCCTGCACATGATGTCCAACATTCAATCAA
AAATTATGAAACACACTAAGGAAAGAATAAAAAATTGGTGGGACAACTGAGTATCCATAG
GCTAAGAAGTAAGCTGGACCGATACCTCGTACCACACACAGAAAAATTTTTTTAAAAACT
CAGTAGATTAAAGACCTAAAGGTAAGATTAAGAGCTGAAGTAGCATTTGTGTGTGTTTTT
GTTTGACTTGTGGACAAAGATTTATAGACAAGTGCAAAAAATAAATCCTCTTTTACAACC
CAGAACGTATATGATACATGTAAGCAGGAATACCTAAGACAGCTTAAAGTGATGGGATAT
TGATAACTAAATAGGTTGATCCTAAGACTAAAAAGTTGATAAAAATCACAGGTCATGAGA
GAAATCTCAGCTATATTGATTCAGTATTCCAATTTCATATTGTGATACAAGAAGTGGCTT
TTTTAAAAAGTCTTCTATCTTCAGAAAATACATGGAGTTGAACACATATTTACTATGTTT
GAATCATGTTTGTTTAACTCTCCTATTGGCATAGGCCACATCTGAACCATTCCTGAGGGT
GGTAATAGGAGAGAAAATGATTTGAACTCATTGATGATTAGAGAAGGTGGCAGCAATTGA
GAACCTGGCAGATCCATCTACCCCAAAAGTGAGCCTATAGTCAATTACTTGAAGAAATTA
ACTCTCAAATGTCCTAGACAGAGAATTATAAAATTGTCATTAATGTGTCTGTCCATAATT
CAGTGGAAATAGAAGCCTCCCCCAAATTGTGGGCTGATGAGACACTAGATTAAGCATCAG
TGTTAAAATTGGCATCCTTGACATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved