Spermophilus_tridecemlineatus Locus Mono:18:SNORA33
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:18:SNORA33
Spermophilus_tridecemlineatus
Mono:18:SNORA33
scaffold_12119
SNORA33
1001..1110
2110
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGGGTGCTGCTGCCATCACAAATGGTCT
CACTCCTGCAAATAGTACTCCTGCGTGAGTGAGTAGTTAGAGACCTACTCTGATGCTGAG
GCCTGAGCCCTGAATGGGCACCATGCTTCCTGCATGAAGTGGGAGGGGGTGATGGGAAGG
CAGGAAAATCACTCACAGAGAAGCCATATTCTCAAAACTTGAACCTCAGTTCACAAAGCA
AGGCAGAATGCCACCACCCTCTGGATCACCATCTTGGAAGCCCTGTTTATTCATGTTCTC
TAAAATTAGAGACCCCTTAACAGTATCAGGATCATACCATTATTCTTCTATTTTTTAAGT
TTTTAAGAGCTTAAGATTAAAACTTTTTTCTTTCCACAGTAGAATCTTAACACTTCATTT
GGAAGATTCTGTAGGTTTCCAATCATTATCTCAAAAAAAAAAATCTATGGAAATAATGTC
TTGCTTTGTCTTTAGTAAGTGCATGAATGGACATTTGCTACATCTATAACCTTTAAAAAT
AATGGTATGAATCTGCTCCAAACCTGGCAGGAAAAATAAAGATCCCATTTTAATTCTTAT
TTCTTGATGTTTGAAAATCATATACTTTTTCTAATAGAGAGTGAAACAGTCCCCGAGAGA
CCATTCTTTACTTTTCACTCAAAAGAAGAATTTTAAAATATTATATAGTAAAAAAAACCT
TACTAACCAAATAAATAGCTTCCATGCAATGTTGTTAAAGTTGAAATACTGGGTTGTCAC
ACACAAATCAAAGAATTTTTATTCCTATCATAAAACTTACAGAGAATGATTATAACAGCA
ATAGCCTATGCAACATAAGAAATCCCACTTACTAAGCACTATGTAAAGTGCATTAGAAAT
ATGTCAGCATCTTCACAGAAACCAGCAACATTGATATCCCTAATGTATATTCATTGTAGA
TTGTATACAAAGTCAGTCTGGCAATAGTAATGCCATCTTATTAGCCTTCAGGACACTGAA
GTCATCATGGTCCCTGAAAATGGCTACAAAGGATTTTTTTAAAGTCAAAAAGGCCAAGAA
TCTTGCTCTGGATTGAGTTTGAATTAGGCAATGACTTCAAATCACATTTTGCCTCATTGT
ATTTTTTGTTCCTCTTGAAACAAGTATGATGATTTGCATGGACTGATTCCTTATGGAACA
ATAAATTGTCACTTTTTATTGCAAAGTACTTGATGTACAAGTGTTTGAATCATTTTTCCT
TTGTGAGAGGTCAGTAGAAGAGAACTTAGATGGTAAACTCCACAGGGTATATTTTCTGCA
AATTCAGGGAAAGTCTGATATTTTTTTCCTCAATCTAGCAATTACAGTGCAATGCCTTAT
TGTCAAATTACTATATCCAATGATTGTGATATTTCTTCTTGTTTTCAAACAGCCACATTT
TATTTTTAAGTACTTCCTTCTAAGAACTTTACAGAGAGTTGTAATGTTGATGCTCTAACT
ACCATTTTAATCTCTCATGAGGTTGATTGAAGAAACATGTTGTATCCATCAAAAACTGCA
GACTAGCAGAACACGCAGATCGTATTTTAAGGACCCAGAAAGATTAAAAATGAATGGAGA
TACATCACTATTCCCACTATTTCCACAAAGCCATTTCAATTTATCCTTATAACACTAACT
TTCAGAGTTAAAAATGTAAAGTTATTGAATAGTCAGAATAAATGATAAAAAGACCGTTAG
TTTAAAAAAAGAAATATGCACTTTGATGAAACTAAATCTTATTATGAGATAAGAAAGAAT
AAATCAAAAAATGCTAAGTGGCAAGTGGAACCAGTGAAGACCACACCCCCTCAAAATGGA
AGAATCAATAAAAAATAAAAGATTAAGACTTCTGAAATATGGATAAATTAACACCCAGAA
CATTCAGAACACTACCCCATTTTTGTATCAAAGTCCAAAATCAAAATGTAAGTGAAAAAA
CAAACATCCTGGGAGTTTTTTGGGTTGCTTAGAAACCTTTTTATGAAGTTTACATGTATC
AGCTGTTATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved