Spermophilus_tridecemlineatus Locus Mono:133:SNORA61
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:133:SNORA61
Spermophilus_tridecemlineatus
Mono:133:SNORA61
GeneScaffold_3497
SNORA61
1001..1127
2127
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTACACTCGAAGAGTTTAATAGCCCTGTGTTGGAGTATGCAT
CAATATCTCAAGACTGTGTCTGTACTAGACCACTGGAGACATGATCACAGCCCGACACTC
ATAGCATTGGGCCATTTACTTTTCTCTGTACCACCTCCGTCTTTGGAGTGTCTAAGGATA
GGTTTTAGAATGTTTCTAAATTTTTATTGAAAATTTCATATAGCCCTCTGCTTCCCTTTT
CTAGTGGACCTGAACACTGGTCTTGGTGGCCACAGAAGGAGGAAGAGTAAGAAGCTATTC
TCAGCATTGTAGTCTGGTGTGGTGCATATGGGTTAGGTTCCAATAGGGTTGAATTCTTTG
AAATTGTTTCCTCTTGCCCTGTACAATGTGCAGAACTCTGATGGTTGAGGAGAGGAGTGT
GAAGCTCTGAGCAACTGAAGTGGGAATTGCTGACTAATATTATTATATTTAAGTGGTGCT
TTCTTGTCTCTTGACAGAGTCAGTCTCTCTCTGTCTTTAAAGATCTATGTAGTCAGTAAA
AAGGTCTTTATCTGTGATTACTAGTCCACAGAATTGAGAAAACCCCATAAGAAGGAAGAG
GCAGGCAAAGAGGCAATCAGTTATGATAGATGAAAACAGTAAGCTTTGTGAGCACTTTTT
TTTTGATAAGGCTTTAATATGTTACACATCTATTACTATAAGGCAAACAATAATAAGACT
TTGGAAGTGGGAAAGGAAGGAAAGAAAATTTAATATTGATTAAATTTAAGTTTGCTGGTC
CATAAGTAAATAATAATGGTATAATTCAATTCAAACTTGGGGTAGCCAATTCAGAAGCTT
GATGCTATGATCATGATGTGCAAGAAACAAAATGTACACTTGGAATAGGCCTCCAGAGTT
TCTTGGATAGTATGCCATGTGTATTAAAATACATTATTATACTATAAAGAAGAGTGTGAA
TGAAAATATTTTCATATGTTAAGAGTAATGAAAGATACTGAAGTTATGCACAGCAAATCA
AATACAAAACTTTCCTTTTCAGACCATGAGTCTTCATTTACAATATGCTTAAATTGTATA
TTTCATGTAACTCGTTCACTGGGATGAACAAAAATTCTGGCTACTAGAAATAAAATATAA
AGCGAAAATAATGATAAAATTATAATAATACTATGATAAAATTATAATAATAGTATTAAG
AAGAATGACTTGAGTTAACTTCACAAAATATCACACCTGGTGATCAACTCAGTTAAGTTG
TAGAAAAAAATCTATACTATATAGGAACATGTGATGTGTAAAAATAAGTATCTCATTATT
ATTTTCTTGAGATGTTGAAGTTATAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved