Spermophilus_tridecemlineatus Locus Mono:199:SNORD29
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:199:SNORD29
Spermophilus_tridecemlineatus
Mono:199:SNORD29
GeneScaffold_3586
SNORD29
1001..1080
2080
TCTTTGCTAGGGTAACATGGAGTTCTAATCTGTTTTTGGGTTTTTTTTTAATCAGTTTT
TTAATTACTTGTCACAAACTGTATCCCAGTTGACCTCATGGTTCTAGGTAATAAAGCAAA
TTTAATCCTTGTGAGAACATCTGACATAAGGTTCTTAAACAAAGGCTTACGTGAATTCAG
CTTTGTATTCCGTGTTGAACAGTTTTTCTGGTGGAGACAAGGTGAGAACTATGTTTAATG
CATATCTACATGTGTCAGACACTCTACATATCCACTGCACATGTCTCTACAATGATTCTA
TATTAGTATGCCTATTTCTGTCAAGGGGCAAAAGAGTAAACAAGCAACGAGTAAATAGCA
GAATTGAGCTTTAAATTGGTGCTTCATTTTTTATTTCTCTGTGTGATTTCCCAACCACGT
TGAGTACCCAGAATGTTATCTGTTGAGTGCCATCTTCATGGGGTTATTTATCACCCCTCT
AGTTAAGTCTAGCTTTGAGAGGGAAAAGAATACAGCTCGGGAAAGCTGTGATTCATAACT
GGCCTGAGGGTGAATTGGAATGCTATGTTATGGTCAATCACTTAGTGCATAATTAGAGTG
TAATGAAGAGGCAAAAACTAAGGGACATATAGAGCCAGCCTTTGTCTATAGTAATGACTT
CTTGTGGACTGGGTCTCCACTTTTATTTTCATTACAATTGCAGAAAAATGGTAAACAAAA
ACAGAGGTAGGATGGCAATAGGAGAGGTGGGTAGAGAGGAACTAAGGGGAAAAGAATCTG
TAGATTTGTTTACCACTAAAATATCCTTCCAAAGGTAGGTTTGCCTGGGTGACATTTTAA
ATATTTTTCCTAATATTTATGATATTTTTATCATTCTGTGCCACCGTCTCTTGAAGAATT
TAGAACATTAGAGTAACATTTAATGTTATCCAAGTTGAACTGTGAATTTAATGCCCATAT
CACTATTCCAAAAGAGAAGCACTTCTAGGTCTCAAACACTTTCATTATGATGAAACTTAC
TAGCTCACCATGCAGACTTTCTATCTTTGAATAGTACAGTTGATATCAACAAAAAAATGT
GTATTCCTATTATTTTTTGGAAATGATTCTGTAAGCATATATGAAAGAACTGCATAGCAA
CATGTGTCCCCAGGCTGACTGGATTCTGGAAAATTCCCCAGTTGCTTCAGCCTAATGTTA
GCAGTTGTAAAAATGAAGGTCATTCATTTGGTTTTGGTTCAACAGAAATTTGCAAGGATG
GTTAGATTGGGGCCCTTTCACAGTTTTCCACTGATGTCAAAGCAAATCACCAGACTTTTA
TATTTGGGGTGTGTGTGTATGTGTGTGAGTGTGTGTGTGTGGTGTGTGTGTGTGTGTGTG
TGTTTGCCATGAAACTCACATACTTTCTAACTGCTCCTGTTTTACTCTGAAATGGTCTTT
CTGTTGTTGGCCTACTACAAACCTCCAATGAGGAGAAATAAGTAGACTTGTGTACTTTTC
CTGCATGTGATACAGGAAGTGCCTCCACTTCCTGTATCACATGCAGGAAAAGGTAAAAAC
GGGATGGCAAAGAACATGGTGGGGAAAGGAGGAAGAAGGAGGTGGAGGTTTGTAGCTAAA
AGGGAGCGTGTCCCTACTCTCCTAAGCCAATTGACCATCTCACTCCCTTTTTCCCAGGCC
TGTGACCAGGCTCCTGAGTCAAGCTGTGGTTTTCCCCACATCCCTGCTGAGTGACAGCCA
GGCTTGTTGCAGAGCCCCCAATCACTGCTCAGGCTCTTAGCACGTGGGCAACACTCTGCA
AGTGCTCATTGGTAAAGAGCATCTCAGTCACTCAGCTTCATCTCTGAAAAGATTCTCATT
ACTTGTGCTTTTGTCCTCTCCCTCACAAGGTCAGTGCTTCTGTGACCACTTTGGGGAACC
AGGCAAAGTGAAAATCCAAGTCATGCCAGTGAGGGCTTCATTTTTATTTAAGTTTTAATA
TTTTGTTTATTGTGGATTTGTAGCATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved