Spermophilus_tridecemlineatus Locus Mono:77:SNORA29
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:77:SNORA29
Spermophilus_tridecemlineatus
Mono:77:SNORA29
scaffold_70971
SNORA29
1001..1126
2126
TTCTAGCCAAAGGACCAGGAAGGGGCAGCCTAGCAAGTGAGAAAACTCTCAGAGAGTAA
CTGCTCTCCTCTAGCCAGGAATCAATAAAAACTGTGGTCCCACCACCACCCACACCAGCA
AAGCCTGTGTGGGGAGCTTAGACCTCCACCCTTGCCAGGCTCCTAACGAGGCATCCCAGT
GATCCTGCCGGGGTGGTGCCAAAGAAGGTCAGAGGGAGCAGGACCATAACAAGCCTGACT
CCCGCTCTTCCCTGTGTCGGTGAAGACCATCTGAGGAACACATACTTCTACCCTGTCTCC
CAGTAAGAAGGGCTTCTTTCCCTCAATGGGTGGGCACAGGTGAGGCCTACTGGAGAGGCA
AGATGAGGCCACCCTCCCACACCTAGCTCAGTGTCCCTGGAAGACATGTCAGGATCAGTA
GCAAGGCACTCCTATCCTCCCAGAAGCATCCACCTCTGCCAGAACTCCCACTGCCACCTC
AGCTGTCAACAAGAAGCAAGCAGAGAACCCGAATTTCTGTCTCTGCCTGGTAATAACAAG
TAAGCTAGCTGTCCCCTTCCTCTGCCAGAGTGTCAAAGAAAGTCATTAACCCAGGAGATT
TAAAATTGATCCAGAGTCTCAGAACCCAACAACAAATGTCTAGACTTCAAGTGACAAAAA
TCACTTGACACAATGAGAAGTGGGAAATCACCTGAACAAAAATTCAATCAACTGAGGCCA
ACACCAAGAGATGTTAGGATAATGTGGTAAAGGTTTAAAGCAGCATAAAAATGCTTCAAC
ACACAATTATATATAATCATGAAATAAATGAAAAAGAGGTTTTATCAAAGAAATAGATAT
AAAGAACCAAACAGAAATTTTAAAACTAAAAATCACAATAACCAAAATTTTAAAATTCCA
TGGGTAGGCTCACACCAGAATGGAAGGAACAAATTAAAGAATAAGTAAACAAGAAGATAA
AGCAATAGGAATTACCCAATCTTAACAATGGAGAAAAAAGAAGACTTAAAAAATAAGCAA
ATAAGCAGAATCTGTGGCTATGCTTTTGGGATAGATTAAAGTTGCCATGATCTGAAGAGG
ATTTTTCAAATGTTCTCCTTCTATATGAAATAACTGAGCAGAGGGGAAAAAAAAAAAAGC
AAAAAAACATCTCCTATGGAACTGTAACACTCTTGTCATCAGAGTTCAAAAAGATGGGAC
AAAAGGGTGGACCTAAAAAGATAAGACTGAAAACATCCCAAATTTGTTTATAGACATAAA
CTTTTAGACTTGAGAAGGGAACTGTAAACTGGACAAAATCAAACAAAATCTATATCAAAA
CACAATACAAACTTTTCATTACTAAAGGCAAAGAAAAAAAAATTTGGAAGAAGACTTAGA
GCAAAAGAGCCTATTGAAAAATAACAATTTAAATGACAGTGGGGTTTTCACCACAAATTA
TGGAGGCCAGAAGGAAGTGCACACACTTTGAATGCTGAGAGAAAAAATCTGTCAACTCAA
AATTCTTTTGTCCAATGAAGACACTTTTCAGAAATAAAGGGGGGAAATCAAGATATTCTC
AGACAAAGGGAAAACTAAAAGAATTCATCACCAGCACATCTCAACTAAAAGGATAGCTAT
AGAAAGTCTAAACAGAAAAGAAAGCAGTTAAAGAAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved