Spermophilus_tridecemlineatus Locus Poly:6:SNORA63
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:6:SNORA63
Spermophilus_tridecemlineatus
Poly:6:SNORA63
GeneScaffold_556
SNORA63, SNORA63
1001..1133, 1898..2027
3027
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTATCTCCTTAGACTCCTCTTGGCTGTGAAGGTTTCTTAGTATTCC
CTTGTTTTTGGTGACCTTGACAGTTATGAGAGTATGGTCAATTATTTAAATAGAATGCCC
CTCTATTAGAATTTGTCTGATTTTTAAAAAGAGAATTACACAGGATTTGGGGTTTTAGGA
AAGAAGACCACAGGTATAAACTGTCATTCTTGTCATTCTATATCAAGAATCATAAGTATT
GATATTGATGTCAGTTACTTGGCTGAGGTAGTATTTGTCATCTTTCTCCAATGGAAAGTT
ACCCTCCTCCTTCCCTCCCTCCATACTGTACTATTTGGAAGGAAGTCACTATGCACAGCT
CCCGCTTAACTAAAAAAAATTTTGAACTATCCAAAATGGATCAAGTAATTTATTTTGAAT
GAAGTAGATTAAAATGTTGGGCTGAGATTAAGGATCAAATTCATGAGACTTACTACAAAT
TGTGTACAAGTATTCAGGTGTACATGAGACTTTTCTCTGGCTGGCAGGTTGGGTATGTGG
CACTATAGCTGCAAAGTGCTATATTGTCCTTTCCTCCTGCTGAGAGCAATTGCTTCCCAC
AATCTCTGTCTTACTCAATTCTGTAGTAAGACAGGGACGCTTGGTCTCAAACATGTTTTA
TGTAGTAATTTTAAGAAAACTGATTTATTTGCTTAATTGATTTGTCAGTATAATTAATGC
TTATCTCTTTTTTAAGGTTGTGTTGCTTTCTGCTGCCATGCTAATCAATATGTTGGAAGT
TATCAAGAAGTTCATGAGACAGCCAGTTTCAAATTCTGAAGAAAAACGAAGAGGCAACCC
TTGGACATGTCAGTGTTTACAGAAATTTTGGAATAGGGTAATATTTTTGTCATTCGTACA
CATAAATGTACCTTCTCTAAGGTTTGTACTAAAATTTCAGAAACTAGTATCATGTCTTGG
TATTTGAAATAAAGCGAGCAGAGTAAGCACAAGAATCAAAAAATAGCTGAACAGCTGTAA
CAGAAGAAAAACTGAGATAGACCTCTTCTAAGACACCCAAATTCCCACCTTCTAAGAGTT
GGTATAATAATATCTATACTTAGGCATGATTAATAGAATGAGTGGTCTCTTCCAGTGGTA
GGGGTGAAAGTTAGAAATCAGATAGCCCTTCATTCCCACTTTGATAGAAATTAACATTTC
CTCTCTGAAAAAACATAAGAAAAGTAATTATATTTGCTTTGTGACAAATGAGAGACTAAC
AATCAGGCCATTCTTTGTAGAACACAGGAAAAGGATATACTGGCTTCTAGAAAATGCATT
TTGGGGATTTCAGTTTTTGATCTGATAAGAGCTGTTCTTCCCTAGTATTATTACTAATTA
AGATGCTGTTGATATCTAGTTATTTCCATAGAAAACTGAAGCAGGATCTAGTTACAATGT
AGCCATGAAGTGCTTCATTGTGTTTTCCCCTGCTCAAAATAAAACTGTTACCTTCCAGGC
CCTGCCTGCCTTGGTGCCCTAGCAGCAGGGATGCTTGGTCGCATACATGCCTACCAATAT
GAACACTGACTTGGCAAGTGACTCTGAAGAATCAGGATTTGTTAATGTTTTGTAGGTGGT
AACAGAAGGAAAAAGATGCTATCAGGAGACAATTCAAATAAGGGAAAAACTATTTTGATT
GCTCCTGACTTGCTGGTAAGTATTTTAATTTCTTATTTAATTACATTATTTAATCTATCA
AAGGTTTGTTTGAGAGGAAGATTTATAGTAACCCTGTCATTTGAAGCTGTGGAGGAGTAA
AGATCATATACAACTGGCTGGAGTGGCACATGTCTGTAATCCTAGCCCCCTGGGAGGCTG
AAACTGGAAGATCTTAAGTTCAAGACTGGCCTCATCAACTTAGAAAGGCCCTAAGGAACT
TAGCGAGGACCTGTCTCAAAAAGTTAAAAGGGGATGTAGCTCAGTGGTCAATTGCCTCTA
GATTAAATCCCAGTACCAAAAAAAACAAAACAAAACTAAATTAAACTATACTGTACCATT
TCAAGTAATTCAGTACTATTTTATGCCATACAAGAGCATGTTGTAGTTGCTTTTTGAATA
CATACTGTCATATGGCAGATTTTTTATTTTTATGTACAAATTCAATCTATGGTTATAAAC
TGTGATCACTACTTGTGAAAATTATATTCTCAGTTAAAAATCTATTATGTGCTTTGAATT
CCTTGCTCTTATTTTGATGAAGTAAATTCACATTTTGGTTTTCAAGGTGATTTTTGTCAG
CCAGATAACCTTGAAAATCAGGCAAATAAATCAGGAAAATAATCTTATCACCTTATAACA
AGATAATATTTATTTAAATTATACTTGGCAGGATTCTGGTAGCTGAGCATATAGTGGGAA
AGCAAATGTGAAATGTAGCCCAGATTTTTGGACTCTATAATGTTGACTGGGAGAGGTAAA
AACATTAAAGATGCTGTTAGATCTGATTGTCTTTAGCTTACAGTAAGTCTTCTATCTTGT
TTGTAAGACACACTGCTCCTATTTTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved