Spermophilus_tridecemlineatus Locus Mono:172:SNORA38
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:172:SNORA38
Spermophilus_tridecemlineatus
Mono:172:SNORA38
GeneScaffold_4513
SNORA38
1001..1133
2133
CTAAGCACACACTCTATTACTGAGCCTCACCCCATCATGCCTGAAAATATTCTGGGTTT
TTGTATTATTGTTTTGCAGTACTGGGGATTAAATCTAGGGTGCTCTACCACTGAGTCACA
TCCCTAGACCTTTTTGTTTTCAAACAGGGTCTCACTAAGTTGCCAAGGCTGGACTTAAAT
TTGTAATCCTTCTGCCTCAGCCTAGGGAGTCACTGGAATTATAGGCCTGTACCACCATAC
CCAGGGAAAATAATCTTTACACTCATCACTATTTTGAAGTTATAGTAGCTACCATACCCA
CCACTAGAGCTTATTTAATGCACTAATTAAAAAGCACATATATTATCATATATTTTTTCA
TACATTTGATAACTTTAAAATTCTATATAATTCCATATAATTTCCTTTAAAATCCTATGT
ATTTTATGAATTTAAAAGCATTACTTTAGGAAATGGTTCACTGGCTTCACCAAACTGCTA
AAGGAGGTCCGTGACACCACTACTACTAATAACAATGACCTCTGAGTAAACAATGTAGTA
TATTCAGGGGAGGAGGAATCAAAAGGGCATACTTTTAAGAAGCAGGGCACTATCCTAGTC
TTGGCCCCAGTCATCTGTACCTGCTATTTATAATGTAATTCTTGTAATCTTGAGTAGGGG
GGGGAGAATGAAAGCTTACTGAAGCTTTGGTCAAAGTGAAGGCCAAGCGGGGCATGCCGG
AGCATGCCTGTAATCCCAGTGGCTCGGGAGGCTGAGGCAGGAGGATTTCAAGTTCAAAGC
CAGCCACAGCAACTTAATGAGGCCCTGGGCAACTTAACAAGATCCTATCTGTAAATAAAA
CATAAAAAAGGGATGAGGATGTGGCTCAGTTGTTGAGCATCCCTAGGTTCAATCTCCAGT
ACCCAAAAAAAGCCAACATTATTGTTGGCTATTGTTTTGAATATTCCTTACTTTTTTTTC
TGTTTATTAGAAGTTAATATCTTAAGAATTCTCTGGAACTTTTGTCTTACAAAGGCATTT
CTTTGGTTCTCTATCTTTGGACATGTAAGCATTGGAGGAAAAGAAATTTTGTGGATTTGG
AGAAGTCTGGGGCCAGCTTGTTCAGTGTAGGCTCAGGATCAATCACATAGAACAGGAGGA
AAAAAAAAAGAATTCTCTAGATCAGGGGCTGGGAGTATAGCTGAGTGGTAAAGCACTTGC
CTAGCATGTATAAGGCTCTGGGTTCAATCTCCAGCACTGGAAAAAAAAAAAATCTTCTCT
AGATCAGCACACCCTCCCACTACTCACGGTGATAGGGATTAACACAGGGCCTTGTGCATG
CTAGAAAATCAGTCTCGAATTTCATGCTTTGGGAATGATCCCTCTAAAAGCAATTTCTGA
ATTAAAATAGCCAAAATTATTAATTGATAAAAATTTTGAACTTAGTAAAATACAGAATAT
TCTCTTGAATCAAAGAGGTAGAAGGGCCAGGTGTGGTGATACATGCCTATATTCTCATCT
ACTCAGGAGGCTGAGGCAGGAGGATTGCAAGTTTGAGGTTGGCCTAGGCAATTTTGAGAC
CTTGTGTCAAAAAGAAACTAAAAAAATACCAGGAGGGTAGATCAGTAGTAGAGTGTTCCT
GGAAAATTTCTGCCTATTGGGTGTGGTGGTATACACTTGAAATCCCAGCAACTAGGGAGG
CTGAGTCAGGAGAATAACAAATTTGAGACCAGCTTCAGTAACTTAGTGAGAGGCCCTAAA
CAATTTAGCAAGACCCTGACTCAAAATAAAAATAATAGGAGCTGGTGTTGTGGCTCAGTG
ATAGAGCTTGCCTAGCATGTGTGAGGCACTGGTTTCAATTCTCAGCAACGCATATAAATA
AATGAACAAAATAAAGGTCCATCAATATCTAAGAAAAATTAACAAAAAATAAGATAAAAA
GTAAGAAGGGCTGGGTATGTATCTCAGTGGAAAAGTTGTCTCTAGATTCAATCCTCAGTA
AACAACAACAACAACAAATTACTGACCATCTAATAATCTAGCTCCCCCATGTTAATACCC
TTTATTGTTCATCCTTTGTTCTCTGATTCTATCTATATCTATGGTTGTGTCAAACAAGCT
ACTCAGGGAATACTGATATGGTTGTAAGACACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved