Spermophilus_tridecemlineatus Locus Mono:65:SNORA40
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:65:SNORA40
Spermophilus_tridecemlineatus
Mono:65:SNORA40
scaffold_125667
SNORA40
1001..1120
2120
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGTACCCAGTATGTAGAAGAAGCAAAACAGATGTTGTTCC
TGCTCTCATCAGTTTTAAAATAGCATGAAATTCATTATTCCAAATTAATTATTTTTATAG
TATATATAAAATATTTATATTTTATATGTACATCTTTATAAAATATTATATATGTACATA
TTTATTCTATATATATATAAATAAATCCATTTATATGTAAAAGGATTTAGCCTCTCATTT
GCATATTTTTATTTTCTAATTGATTTTCTTAAATTTTATAACTTTCTCATGAAAAATACT
TTATATTCCAATTTTACATTAAAAACTAAAAAATGTGATTTAACACTTGTGTGTGTTTAA
CTTGTGAACAAATATTTATAGACAGGTACAAGCATAAATCCTCTTTTGCAATCCATAACT
CATTGTTCATTATGAGTTTGGTAAATGTAATCAGGGATATTATACATAAAACAGCTTGAA
GTTATGGGGTTTAATAATTTAAAAAGTTGGTTATAAGTCTAAAGACTTGATAATCCAAAA
GTATAGGTCATGAGCAAAAACATAATAACAATAAACTAATAACTATTCCATAACAAATTG
GTAAACCTGATGTTGCATATTTATCTGGTAAAAAGTTAATTGTTCAAAGAATGTATTTGT
CAAGACACTGTAAACATTTTATTCCAATCCTTATTTCTGTCCTCACATGTCCTTTTTCAA
TATGCTATAATGTATTTGAATCCATCTGAAAATTTGTTAAAAATTTTGCTAAATATGAAA
AGGAAGTTGATCTTAAGAATTACTATAAATGGGACACATTATTCTAGAGAGAGGAAATAT
CTCATTTATGTCATGTGCCTGCTTATTCTATATATAATCAGAGATATCTTTGGTCTGCTC
AAAATAGATTCGTGCTAACTCACAAATTAACAGTGGAAATGGGAAGAAAATATGGAATGG
GCAGTTCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCCTGGGTTATTTAGA
AAACCAATTTAAGGTAGGTATCAAATCAATTGCTGATCTCTTTCTGTTGTATTAAAGTCA
ATACACTCATATTCCTCCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved