Spermophilus_tridecemlineatus Locus Mono:75:SNORA73
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:75:SNORA73
Spermophilus_tridecemlineatus
Mono:75:SNORA73
scaffold_131663
SNORA73
1001..1202
2202
TTTCTATTTGTTACGAAAGTTTCCAGCTACACACCCACAAACTTGTTTCTATAACTTAC
ATTACCCAGCAAGATCCCGCGCGAGGGCTCTAGTATCGCGAGAAGCCTAAAATCCCGGTA
GGACTGTAGTTTAACCTCAGTAGATCCCAGCAGCCTTAGCGAATTTCCAATGCCCTATAT
GCTAGTCGTTGCGCAGGCGCAATATGCCTACCTCGACTTCCGGTCCCTCCTGGGTATAAA
TACAGATGCTTTGGCGTAGTCGGTCTTTTGGAGCTACACTACCGTTCAGCGCTGTTTTGG
TTGGTAAGTGCTTGTACCCGCGTGGTTCCTCTGCCTGATCTGTTACTTTGGGTAGGCGTT
CAACATTCCCTGAGGATCATGTTGTTTAGAGGGATTGCCTTTAGCTGCATCCACTCAAAC
TACATTTAGGCATGCGATGGGACTGAGCAGGATGTGGGCCGCGCAGCCCCAGAAGTTTTT
AGGGACTGCTATCCGGGTGTTAATTGCTGCCTGGTACATGATCCGGAAAAGAATTGCACA
TAGACGTTTCGTTCCCTATCCGCGTTTTAAAATTTTTCCAAATTTCGGGCTGGGGTTGTG
GCTCCATGGCGGAGCGCTTACCTAGGATGCGTGAGGCACTGGATTCGATCCCCAGCACCA
TATTTTTAAAAAGAACTAAATAAAGGCATAAAAGGAAAAAATGTATTCAGGGCCAAGGTT
GTGGCTCAGCAGTAGAGCGCTTGCCTAGCACATGCAAGGCCCTGGTTTCGAAATATGCAA
GAAAAGTTTCGTGGCAGTCTTCTTGTAGCCCTACAATTTGGTTTTTTTTTTTTATTATTA
TTGAGGCAGTTTAGCGATACTAAGTATTTGATCGCTTAATTATGAGATGACTGGCTTTTT
TTTCTTCCTTTGTGGGGCTGTGGATTGAACCCAGTGCCGCTATCAACTAGAAACTAATAA
TTGGTACAGTGTTGTAAGTTAAATGAATTAACAGTGACGGTCCAACGTGGATACTCTCGG
GAGGTCTCTCCCCGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGCCCCATGA
TGTACAGTCCCTTTCCACAACGTTGGAGATGAAGCTGGGCTTTATGTCTGCACCTGCATA
TTCCTACGACTTCTCAGAGTCTGTGGACTATGACTGAGGAGACAAACCATGCAGGAAACA
AAAGGATTTTTATTAGTCCCTTGTTTATGGTAGATCTGCTTTAACCTTTACTGTATTGAT
AAGTGAATGCTTTGTTTTGCAGATTCATGATTCTAATACTTCTTGCTTGGTAAGTAGCCA
ATGATGTTTAACATGATGCTCATGTTGTGAAGTTGCTAGTTCACATTTTATGTGTTGAGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved