Spermophilus_tridecemlineatus Locus Mono:90:SNORD78
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:90:SNORD78
Spermophilus_tridecemlineatus
Mono:90:SNORD78
scaffold_11481
SNORD78
1001..1061
2061
ATAGCTGTATTCCTATGCATCAATGAAAGAAAACAATATTTTGAAAACTATGATATTTA
TGATAGTTACAAAATATAAAGAATTTAAGAATAAGTCTAATAAAAGATGAGCTTCATCTT
TATGGACAAAGTTATATGACTTCAATTGAAATACACTAAACAAAGTATTTATATACTTTT
AAGAAAATATAGATAATTAAAGGACCAAAATTCCATAATCTCACTACCCAGACAACATTG
TTTTTTCCTTCCAAGATTTTCCCTATACTTTAAAAATACATGTGGTTTCGCTGGGCATAG
TGACACATGTCTGTAATCCCAGAGGCTCCCGTGGCTGAGGCAGGAGGATTGCAAGTTCAA
AGCCAGCCTCAGTGAGACCCTCAGCAACTTAGCAAGACCCTGTCTCAAAATCAAAAGTCA
AAAGGGCAGGGGATGTAGCTCAATGGTTAAGCACCGCTGGGTTCAATCCCTGATACCATA
AAAAATTATATATATATATGAACTTACCCACTATATACAATTTTAACTTTTCTTGATATC
ACTGAGGATTTTTTTGTGTTATTATTCTTGTGAACATAGCCCAAGTAGAGACCAATCTTT
TATGTCTTAGATGACAGTTCTTTTCCCTGCCTCATTTTGGAGGCCTGGAAGAGCCGACTC
AGGGGGCTGGGTGAGCTCAACCCAAAAGCAAGAACTTTGGTGTTGGATGAAAACTCTCTA
CATTGAGCTCTGAAGGCACCCCCCCATCCCCCTCCCCATTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATGACTGGTATGTGCACTTGTGCACGCACACGTGTATGT
GTGTCGAGTAGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTATCTATGC
TCCTTTGGAACACTGGATGCAGCCCTTCAAATATTAAATATCTGTAATGATGCTGATCAG
ATGAACTGAAATGAGCCTGTAGACAAATTTAACATTGAAGAAGGGAAAAACATTAAATAA
ATATTCCACCATAGGGAAAGCTTATAACTAACTTATTCCTGGACATTTAGGCTCTTTTCA
GTGTATTGCTATTTATAAATAAAGCTTTGATGATTGTCTTCGTGGGTAATGTTCTGTTTG
GTTTTCATTATTTCAGTTCACTTCCTTAATGTAAATTTTTGTTGGTAGAATTAGGCTAAC
ACTGTTAGACAGATTTTTGTGTTATTCATGCACTCTGCCAAATTTCTTTGCAGAAAGGCT
GTGCCCTTTTCCAGTCCCACTGGCTGTGTATGAGGCGTCCCAGTCACCCAGTCTCCCCTC
CCTTTGAGAATCTCTTTGCTTTGCAGTTCTGATTTTAAATCTTGCCAAACCAGGCAGTGA
CCTGGCAGTCATCCTTTCAAAGGTTTATTTAAAGAACTTTCTAATCAAGATTGATTGATT
AGAGTTTCCTGTTCCAGCAGACAGGAAGGCCAGGAAGCCAGTGCACATTAATGACAGTTT
TGTCTTGAGAGTAGGCGCAACATCTCTGTAAATCTATGGGGCTTGTTGTGAGGAGGAAGA
GATTTTCATTGAGCACAACAAAACTTCAGTTACTGTATTTTTCTTTCATTACTGTTTGAA
CAATAAATCTTGAGCTACTCCTTCAACAGATTATTCAGCTGTTTAAGAAAACAGTTTGCA
GATTACTCAATCTACTAATCTTAAATAGATTATTCTTAGTTAAGAAACACTGGTAAGGAG
GGAGGACGGGAGGGAAAGGGGGATTATGAACCAAAATTGAATCCCATACATGTGTGAATT
TGTTGAGATGAACCCAAAGATTATGTAAAACTATAAAGTTCTAATTTAAAAAAAAAAAAT
TAAAAAGAGAAACACTGGTGAGGCAGAGTTCTCTTTGGTAAGAATAGTCCTGAAAAGATA
GGATGAATCAGAATCCCTGGGGAAGTTTATAAAAATGCATCCTTGGGCTGACCTTGAGAG
TCTAATTTCATTCTTACGGGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved