Spermophilus_tridecemlineatus Locus Mono:126:SNORA42
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:126:SNORA42
Spermophilus_tridecemlineatus
Mono:126:SNORA42
GeneScaffold_2235
SNORA42
1001..1131
2131
AGACATTTTTAAATTGTCTTGAAGGCTGAGAAAAAGCTGTTTTGTAAGATTTTGGAGGA
AGAACGTTTCAAGCAAATGGAATGGGTGTTCCAGGAGCTGAATTGACATTCCTGTCTCCT
GAGACCACTTTGTACTAATTATCAGACAGGTCCAAACAGAAGAGAGAAAACAGTGTTTTG
AACAGGTGTGCGTCACCACACAATTTGAACAGGGAAATTTTTATGTATGGAATTATTAGC
TGTGAAAGATTGCATTCAGAAAGGGTTGACTAGTGAGAAGACCTCTATTTAAGTCATAGG
GTCACAGCAGATAGCAGCAACAGCCACAACCTAGGTTGAATTGGAACACTCATAGAAGAG
GGTTTCCCTGTTCCTGTACTGAGACCCAAACAGTGGAGTAGGCATGTCTGAGGCTCACTG
AGTTTCAGGGAAATGGCTGTTGTATCCACAGGTGAAACTTGATAGAAATCCATCTTGAAG
GATGATCACAGAGCAATGAATCATCAGACACCTGTTGTCTCAGCTACAAATTCATACTGT
GGGAGTTCCTGCTACAGACACCTTCCAGGCTGCAGGAGCTTGGGCTGGGGAGCCCCTGGG
TATTGCATAAGTCTTCCTAGTGAACACCAGAATCTGGAAGAGAAACCCCATCCTCTTACA
GTGTTTCTCTAGTGCCTTTTACTGACAAAGCCTAACATCATGCCAGTTGGCAAAGGAAAA
TGAGGCGGGGTTCACTTTATTTAGCAGGCAACTGAAGGAAAAATTTGGAGCTGGGACATA
TTGGTAACTGGAACAGGTTTATATTATCATTCTATAACATCCTGATAAGCCCTCTATATA
ACATCCCTTTACCAGCCACTGGCACTAAGCTCCATTATGTCTTGGGTTATATGGCTGACA
GAGCAGATCAACCAATACAAAACTGGAACATTTTTTTTAATATTTATTTTTTAGTTATCG
GCGGACACCAGGTGTGCGTGCTACTGCTTGAGCTACATCCCCCCCTGGAACATATTTACA
TTATTTAGAAATGGGTCACTCAATAGTTCCCCATGCCAGAGCAAACTGTGGCCTTGAATC
ATTGCCTGGCCTCTGCCTGTATTCTACAGGCACTGAAATGGGTTGCATAGTGGAAAAACA
GTGTGTCACTCAAGCAATCCTGTAGGGAAGCCCCCACGGGAAACTTTGGTCTCCTGCCAA
TAGCTATGTGTGTGATCCAAGGATGACTGGGGCTCCCATTGACATTGTGATGGTAACATC
TGAAAAGATCCTGAGCCAGAACTTAAAACTGAGTGAGATAATGTGGTTTTTTTTTTTTTT
TTTTTTTTTGTTCCAAGGATTGAACTCAGGGATACTTAACCATTGAGCCACATTCTCAGC
CTCTTTTTATTTTATTTGTGGGGGGCTTTTCACAGTTTAATTATGACAAATATTCTGCAT
CTACAATTATCTCCAGTCAATTTTAATTTTTTTTGTGTGGTTGTAGATGGACAGAATGTG
TTTATTTACTTATTTTTATGCAGTGCTAGGAAGGAACCCAGTGCCTCACACATGCTAGGC
AACTGCTCTGCCACTAGCCATAGTCCCAGCCCCACCTCCCTATCCTTTTTTTTATTTTGA
GACAGACTCACTAAGTTGCTTAGGGCCTCACTAAGTTGCTGACACTGGCTTTGAACTTGC
AATCCTCCTGCCTCAGTTTCTCAGGCCATTGGGATTATAAACATGCACCATCACATCTGC
AGATAACAATTTTTTATTATAAACCACCAAGTTTCAGAGAAATTTGTTACACAGCAATAG
ATAACTAATACATAGAACATTTATATTATTTTGTGTTTCTATCACATTTGAATCATAACA
CAAGGTCTTCATTAAAAAGTATGTCCTCTAGCTGGGCACAGTGGTGCACATCTGTAATCT
CAGCAGCTGGGGAGGTTGAGACAGCAGGGGATGTGGCTGGGGATGTGGCTGGGGATGTAG
CTCAGTGGTTGAGTGCTCCTGAGTTTGATCCCCTGAACAAAAGAAAAAAAAATATATATA
TATATGTATGTACTGGGACTGAGGTTGTGATTCAGTGGTAGAGCGCTTGCCTAGCATGTG
CAAGGCACTGGGTTTGATTCTGAGCACCGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved