Spermophilus_tridecemlineatus Locus Mono:175:SNORD73
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:175:SNORD73
Spermophilus_tridecemlineatus
Mono:175:SNORD73
GeneScaffold_4495
SNORD73
1001..1073
2073
TTCCATGGCATGGATCTTACCCGTGACAAAATGTGTTCCATGGTCAAAAAATGGCAGGT
GAGACCCAAAGTTTTCTTGGAGTTCATAGGGTACATGACCAAGGATGTCATGGTGTGATG
ACAGGAAGGGAACATATGTAATGACGATTTAGGTTTCATTTGAAATTTTTGATTTCGTCC
TTTTAAATATATATTTTTTTGTCAGTGAATCTTTATGTGGTGCTAAGAATTGAACCCAGT
GCCTTACACATGCTAGGCGAGTACTTTACCACTTCTTTATGACCCCAGCCCTTGATTGTG
TTCTTGATTTTTATTATGTGCTAACTCTGGTTGCTACTGCTGAGTTTATGATGCCTTGGC
CATCCTTTATTTTATTTATTTTTTTTGGTGGTACTGGGGATTGAACTAGGGTCACACATG
AGCTATGTTCCCAGCCCTTTAAAAATTTTCTTATTTTGAAACATACCTTGCCCAGTTGTT
AGTGATCCCTTTTCCCTCAGCCTCTCCCCAATTGGGGATTATAAGAGAGTGCTACCACAG
CCAACTATGATCATCCTATTTTACTTGACATGTTAAAATTGAGTCCAGAGTTTAATACTG
AGTTTTCATCGATGTGTTTGGAACCACCAGGGGAGGCTTGCAGTTTTGCCTGTTTCTAAA
ATATTTTGGGATCTCAAAATCTAGTGAATTTAGAGTGAAAGAGGGGCTCAGGTTAACCTT
TTGATTGCCTCTGGCTGGGAGGTGTAACAGTGGAAAATTCTCTGATGTGGTGTTTAAATC
ATGACTCCATGTCCCATTATATTCTTGAGAAGTAAATTTTTGTTTGCTAAGCTTTGTTTC
TTGTGGAGAGAAGTATATTCTTTCAATGAATTGTGGGGGTGAAATAAGCAATCCATGTAG
CACAGTGCTTAACACAAAATATTCAGCTGGTGGTACCAGAAAATATATTGGTTCACAAGT
GGCTGGCTAACTGTCTAGTTTTGGAATATTTTGTATATGGGAATGAATGATGACAAAATG
TTTCGGTCCCAAATGATACATCTTGATTATACTGTTACATTTATTTCTGACATTCCCTTA
AGGTTTTATGGTTGCATTTCTGGAAATGTATGACTGTGGTTGTGTTGATGTGTTCTTTTT
CTTTTTGTGGTGCTGGGGATTGGAAATGTTCATTTTAAAAATAAAAGTATGTTTAATAAG
TGGAAAGCAGGCAAATCAATTTTTTCGTGACCACCTAAGGTGGCCTTTTGTATTTTAAAT
TTAGACAATAATATGATCACTCATTATGAACTTTGATTATATATTAGCTGTGAAATTAAA
TATTTAGTTCTCCATAGCTTTAGTTTGGAACATAAAATATTTTTTTAAGAAATGTGCTTT
TACAGTATTTGTTCAGGACAATTTTTTTTTTGGAAGGTGAAATCATATACATTATTACTT
TTAATTTTTTTTTTTTTTTTTGGTCAATGGGCCTTTATTTTGCTTATTTATATGTGGTGC
TGAGGATCGAACCTGGTGCTGATGGTCTACCACTGAGCTACTACTCCAGCCCCATTTGAT
TGTTTATTGTTTTGCAGTGCTGGGGATTGAACCCAGGGCCTTGTGCATGCAAGGCAAACA
CTCTACCAAACTGAGCTATATCCCCAGCCCCCATTTCTTTGATTTTTGATTTTTTTTCTA
ACTTGTGATCCTCCTGCCCCTACCACCCACGTTGCTGGGATTACAGGAGTATGCCACTGC
ATCCCACCTGGTTGTTTTTAATAATGAAATTGAGGGTTGAATTAATGACATTAAAATGTG
TTATATCTGACAGTGTCTTTTTCTCTCTAGACGATGATCGAGGCTCATGTTGATGTCAAG
ACTACCGATGGTTATTTGCTGCGTCTATTCTGTGTTGGTTTTACTAAAAAACGCAACAAT
CAGATACGGAAGACTTCCTACGCTCAGCACCAGCAGGTCCGCCAAATCCGGAAGAAGATG
ATGGAAATTATGACCCGGGAAGTGCAGACAAATGACTTGAAAGAAGTTGTCAATAAACTG
TAAGTGTTATTTTTGTTCCTCTTACAACAGAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved