Spermophilus_tridecemlineatus Locus Mono:89:SNORD31
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:89:SNORD31
Spermophilus_tridecemlineatus
Mono:89:SNORD31
scaffold_7157
SNORD31
1001..1072
2072
CATGTGACTGATTTACATCATTTCTCTCACTATTTTTAGCTAATTGTATAATGAATACT
TTAAGCTTATTTTTAAATCTCTTTCACAATACTCCCATTACGTCTAGCTCTTTGACTGTC
TTGACGTACATATCAGCAAAATTGTTTTCTGTTGCATTTAAGAGACCTGAAATGTAAACT
CCCTATAAAAATTGAATTTTGTGATTGATACAGATTTCTCAGTTCAATCCACTTTGCAAA
ATTATTTTTGTCGCATAATTTCTAGAAATTAAAGATGACTTAAACAAGATAATATGACTA
TCAGCATCTTAATTACTTATTTCATATCCAAAATATGGGGGTAAAAAATGTATAGTCTTA
TTTCAAAGAAGAGGTATCATTTCTGCAATAATGACTTAATGACATGGCCTCAGTTTCACC
TCTCTAGTTGTATTTGAGAATCTATGTCACAATTGTACTTGGAGTTATGAGTTTATTACT
TTTTGAAATATTGATTATAGCAATTCTACTGTGTCCTCTTTATATTTGTAACTATGAATT
GATTCCTTTTTTTTGCATCCATTGATCTTAATTATACATGTGAAAAAATAATCTTTGGAG
GGTCCTTTCATTTTTCTCAGTTTTTCAGTGTGGAAAACTTATTCTCTCAGTTCAGTTCAC
CATGTGACACGCATCCCCTCACTCCCATCAGAGTGTATCATTTTTCAAATATATGGCCAA
AATTCTTAGCTTTCCATTCCTAAATTTATCCCTCACACACGTGACTTCATCTTGCTCTAT
GTGTTAGGTACTTTCATCAATAATATTTGGTCAGCAAGTCTAACATTCCATGAGATATAC
TACAACTAGGCTAGACTTGTTGCTTAAGGATGCACAGACCATTTAAAAATGGTACAAACA
TTCCAAGCCCTGGCACTGAAAAGATTTCTGTCAGCATGAGAGCTCATATGCTTCTGGATA
TTTTTGGAAATTTGGTAAAAATAAGATCAAATAATAACCTATACAAATATTTCAGCAGTA
TTACTCAGCCTAGTGAGACCACTATGTGATAGAAAGGTATTTTCTTACCTGTTCATAAAA
TGTATGATAGCTTCTTCTAGTGGGATATGACTTGATTTTATTATCAGAGCAATGTCAAAA
TGCTTCCTCTGTTTATCAATGGTTCCAGACCATGTAACTGGGCATAAGGATCCTACACTC
ATCTTTTTGTTTTATTTTCACCACAAATTGGTAACAAAACCTTCATAATTTCCAATTAAT
ACTGCATATAATTCTAAGTCAAAACATAATCTGAAATGAAGCATTGTCTACCCATACAAG
GATTTGGGATAGTGAAATAAAAGACATTATGGGCCAATGAAAATCAATAAGCGAAAATCA
TCTCTTTTATTAAATTTGATATCTCATATAAGTTTGGCATTTTGTCTTAACCAACCTCCT
ACATTACAAGATTTTAATATGAAGATTCTGAAACCTTTTTATATGTGCTAGTTGATAATT
TAAAGATCTGTTAATTTTACTTTAATTGTGGTAGTATTATTTTAGAACCACATCAATTCC
ATAGTATTAATAATTCAAACCCCATACACATTCTCAGAGATTTTGGAAAATTTCTATCAA
TTACCTTATTGATCTAAGAATTTCTTTTTCTTACAATGTATAAAGTCTAAACTCACAATG
CTAATTTATGAGAGCATGACTTTTAGTAGGTTTATGTCAGTAGAAAAAAATAATTATGTA
AAATAGACATAGGTGGTTTTCTTGAATATTCATTTGTAACAAGTTGTATTTATTACTAAG
GAAAAAATACTTTCTTTGGTTGAAAGAAAGTACTCCGTTGATATGATGTTATGTCTTCCA
TCAGTTTTTTAATAAAACTATGAAAAACAATTACTTTGAAAAAGTAATCATTATTGGGTG
CAATAAAATGTTTTTTAAGATGAATATACAGATACCTTGATAATTTACTAATGGTCCTAT
CATGGAATATATTAAATTTATTGCTTGATTAGGTAATGTTTGCCAAATATTTCCATTTTT
TCTTTTGATTTTAAAATATATGCTATGAGATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved