Spermophilus_tridecemlineatus Locus Mono:144:SNORA40
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:144:SNORA40
Spermophilus_tridecemlineatus
Mono:144:SNORA40
GeneScaffold_617
SNORA40
1001..1123
2123
ACACCCTCCTCCCCACGCTCCCTGCCTTCACCTGCCATATTGGTTTCACTAGAGGGTGG
GAAATAAAATATTCCATGCCAGGTGTACCATCCCTGGGAAAATCCCACAGGCATGGGATT
ATCTCACGCCACAGATCTATCTCTATGACCATTTTCCCCCACTCTTCTTCTTCCTAAATC
TGGACCCCCCCCCATTTGGTTTTGCCCAGTGCTCAACTGATTATATGTCTGGCTCCAATA
TCAATTATTCCACTTCCTCTGCTTGTCCCCCTCCCTCTGCCAAATCCTCGTGTGTGCTCA
GCTCTTCCCTGTTCCCATAGCCTCTCCTGAACTGAGAGGAGACGGGACGTGCCTCAGCAG
CTACCCTGTCATGAGTCATGTCTGCCATCCTGCCAGCAAACGAGTGAGGAGGGTGGGACC
TGAGGGCGCGGGGAAGGGAAGAGATTTTCACTGGTTGTCAGAAAATAGGCACAGGGAGGG
GTGGGAGCATTAAAGTCAGCAAGACAGCTGAGGATGAGTTAATTACCAGAAACCAAACCA
CTCAACTTAAGCCACATGAGGATGGATTTCAGAAACACCTCCTCCCAAAGAGTTCTTCTA
CAGATTTCCATGGTTACACTGCATGATACACTCCCAGTATTTGGTAGAATCCACTGCAGG
AAAGCAGACACTTCTACTTAGGGATGAGAAACTATGCCAGAGTGGTCAAGAGTGAGAGAA
GCAGAGTGGAATGTGACACTTCTAAGCTCTGACCTGGTGACATCCTGTATGTAAGGACAC
AGAACATCTTTAGTGTCAGCATGATTACTCACTTGGATTGCGGGTCCACCTAATCCCTTT
ACCTACATTACTAAGACAATTTCTCAGGGTCTTTCTGGCCATCACCCTTTGTGTCAAAGC
CCTTTCACATGTGTGTTTGATCTGCCAGCTTCCTGGGTTCAGTCATCCCTATTGTATTCA
TGTTGTTTTAAGAGTGTTGGCTGACATCAAGAATCATGGATAGCACTTGTGTGTGTTTTT
AACTTTGGACAAAGACTTGTAGGCAAGCGCAAAAAGTAAATCCTCTTTTGCAACCCAGAG
CTCATTGTTCAGTATGAGTTTTGATACATGTAAGCAGGAATACTGTACCTAAGAGAGCTT
AAAGTGATGGGATATTGATAAATGAAAAGGTTGGTTCTAAGTCTAAGAAGTTAATAAAAA
GCACAGGTCATGAGAATCTCAGCTTTGTTGATTAAATGTTCCAATTTTCATATTGTGATA
CAGGAGGAAGGATTTAAAAAAGAAATCAAGGAAAAACTGCAGCAAATTTAATTCTCTTAT
TTTTAGTGCCCAACAAATATGTGAAAAATACACAGCCACTAAATATTAGTCCCCAAAATA
ACTGAATCAACAGGGCTGGGGTTGTGGCTCAGTGGTAGAGTGTTCACCTAGCACCTACGG
AGCCTTGGGTTCGATCCTCAGCAACACATAAAAGACAAATAAAATAAAGGTATTGTGTCC
AACTACAACTAAAAAATAAATATTAAAAATAGAATTGAATTAAACCAATGACAAAAGAAC
ACCACATTCATAAACCACCCACCTCCTTCCTAGCCCGTGACCCAGCATCTTTGACAATCA
GGAGTAGCATCTGCGAGCAACAGGATTGGAAGAAAATGCTACTGATCCAGAGCCCCAAGA
AGACAGAGCCCCGGAACTGACTTTCACTCCCATCTCCAAAATGTCTCACGAAATAATCCC
CAAGAACAAGGCATGCTAAAATTCAGATCAGTGAAAATAAATGAAAGTCGGAGTTTAGGG
ACTGGGAGAATTTCAGAGTGCCTGGTACCCCTGATTTTAGAGTAGAAGAAAACTGTATTG
GTTTGTACAATTATATCAAAAGCGCCTACCACAGTGCTTGGCACAGAGTTCCCCTCAGTA
AAAATATATTCAGTAAATGGTCAGATGGGTAAAGTGGGTTGAAATCATATAGGAATAGAG
AGACTGAATCAGGATTAAAGGATCTAGAATAATCTCTAGCCATATGAATTTTTAAAGAAT
TGTTGTAATCTGTTTTTTTTAATGCACACTAGTTCATTTAATCCTGACAATACTCCCAAG
TAGAATTTGTAATGTCTGCTTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved