Spermophilus_tridecemlineatus Locus Mono:12:SNORA67
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:12:SNORA67
Spermophilus_tridecemlineatus
Mono:12:SNORA67
scaffold_138276
SNORA67
1001..1144
2144
CTCCTAGGTGCACCCCCATTGCTGTCGAACCTATTATAGTCCTTCATACCCATGTTCAC
CCAGTGAGCACTTGGGGAAAAGGGAAAATGATTTTCTGTGAGTCTCAGAGTGGTGATGTT
CACTGCAGTGGATTTGATAAGTTCTGTACCCAGTTATGCTTTTCTACTCTTTTTAATTTT
GCTTCAGGATTTTTTTTTATCAACTTTTATCCTGGAGCTCTCACATCTCATTTACCTCAA
TCTGTCTTTATCTCTCAATGTTTAAGACTATGTTCAAACACTCTCAGTAAGTCCTCTCTG
CCTTCAGTGTGATTTGCATCTATTGGTCAGCTGTGTCTTCACTAGAGCCACTTACAAACC
ATTTAACAGTTTTCAGGTTTGAGTATTGGTGCTTTTTTTTTTTTTAAGTCATATAATGCC
CTGTGAATTTTATCTCAGACTGTTGGAGCCCATACACCAGTATTTGGAAACATGGCTTCT
TCCTCCTGGTTCTCTTGCAGGGAATTGTGATATCCACAGCATTGGATATCACATTTATTG
AGCTGTTTTAAAATTGTTCTTTAAAAGCTGCTTATAATAATGTTCAACACTTTCCATTGT
GAAATCATACCCCCAGGAATAATTACTTAATCTGTGTTAAATTTTTCTGCCTTTGTTTTC
TGAACAATTCCATTATCTAACCTTTGTTACATCTAAAATTCTTACTGACTGAGGTTTTTA
TAGTATTAATGTATGCTCTCCCAGTGGTTGGTAAAATAAAGATTATTGATTGATTGAAAT
TAGGGAAGACTGATATGTGGCAATTCCTTCTGTTCTTAAGAATATTTGAGAGGAATAGTT
TTTAATTCACATATATATTCAACTGAATCCAGGCTTCTTTCATAATCTAACCCTAAACAT
TTCAAATATGCCACTCAATATATTTTTGTCTGACAACAAAATCACCATAAGTTCCCAGTA
GAAAATGAACAAAATGCAGGAAAACATAAAGGGTAAAAATGATTCAAGGTGATTTCCTCT
CCAAGGGCCAAATGAGAGCCTCTCTCAGGAAAGTAGGAACTTGGAGGAAAATCTGGCATG
CCTAAGGTCTTTGGGGGAACTGAAGACATGTAACTTCTTTTGCCTTTCTTTGGCTGCTTA
CATATATTTAAAAATACATAAATAAAGGATAAAAGAAAATAAAAGCCATTTGCTAACACC
GGGAAAATCATTGGTAACATTTTTTATCTATTTTAAATTGTTCTCCCTTCACTTACCAAG
AGAAAGTAAATGAGATAAGGAGGACTTTTTGCAAATAAGAGGAAAACAAAAGAAGAAGAC
ATAAAGAAAACAAAGAATAAAAGAAGCCTGGGAGCTGGAAAACCAATCCAAAGCTTCTAG
TGGGCTCTGTACATTTTCCCAAGACTCAAGTTACTCCTGTTTATTGCTATGCCATCCCTA
GAGCTCCCTAAATTCCTACTGCCTCAGTCTCACAGTCTAGATGGCTAAGCTGGTTTTGCC
TTTATCTGTTTTCTAGAAAGGGAATTGAATGCAATGGTGTAGGCATCCTTGTTCTTAAAA
GAGACTTTCTGAAAAGTCCATATTTCTTTCATATACTTTTGTCAGAAATGAGTCAAGAGT
GGCTGGGTACAAAGTGGGAATCTTAGAAAGAGATGGAGAATACAAGAATAAATGAGAAGA
TATATTCCATTTTTGTTAACAGGAATTATCTCTAGATGTTGAGATAATGGGTGACTTAGT
TTTCTGTTTAGGGTGTATGTGTGCATTTGTAATTTGTAAATTTTCTATAATAAGCTTACA
TAACTTTTAAACAAGAGTTAACCTCTGTAAAATAGCTGAATGTATTTGGCATTTTATATT
GTTCTAAATAATTTAACTATCTCTTTAAAAAAAATCTGTGTAAAAATCATACTGAACTTT
TAGTTTGAAGAAAGGAAATTTATCTTCCATAAAGACTAAAAAATTTTCCACTACCACAAA
GTTTACGTGTAATGGAAACTGTCAAGCATTTACAAAGCTCTTGTTTTAAATTTTTGTTTA
TTACACAGAGCCATAGTTTGTCTTTCCAATGAGTAGAACTGATGTTTATTAAACACTTCC
ATGTTCCAGGCAAATACAGCATCTACCTAAGATTCCCAGTCTACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved