Spermophilus_tridecemlineatus Locus Poly:10:SNORA25
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:10:SNORA25
Spermophilus_tridecemlineatus
Poly:10:SNORA25
GeneScaffold_4198
SNORA40, SNORA32, SNORA25
1001..1128, 3558..3677, 3897..4025
5025
ATTATGTCCAATAATTTCGGCAGGAAATAATAATTTAATTTATATAATTGATAATGAGA
AAATGGGCTCTTCAATTTTTTTGGTCTTTGTGGGGGGTTAGATCAAGGAACTTTTGCATG
CTAAATGAGTGATCTACCATTGCATTCCATGCCTATCTTTAATTTTATGAACGTTTTAAT
GTGTGGTGTTAGGCTATTAAAAGAAAAAAGATGCTAATTTAGATTTTTAAAATCTAGATG
TAGTTTAGTTTATTTCAAGTAACCTAGTCTTTAAACATTTGTAATTGCTTTTAGTTATTG
TTTAATATTCTTTTTAATGCAGGAGGATAGTTGTTTTATAGTAAGTTCTGACTTCCCAAA
GAAGACGAACATATATCTAGAGCATGAGAATAATAATAAAGAAACTGCTTTTTCTAAAAA
GTGAGCTTCTAATGCCAAAAATATTGGACAGAATACAGAGTGCCCTTAAAGGAGATGAAG
TCAAAGCAGGTAAATAATATACAGAAAAAATGACTTTTCATAGGAAGAAATGACTAAAGA
AGTTTAATGTGCATAAATGTGAAAGCCTCGTGTTGAAATTCTAATGAAGAACTTCCCAAA
GAGAAAATAACAAGCAACTTGTGAATAACTTTGTAAAACAAATGTAAAGAATAACTTTAG
TAAGATTTTAATCCTAAATAGAAAGATAAAACCAAATATTCAATTTCCTTAGATTTTCTA
AAACATTTCTTACTGACAAATACCAAAGTGGCGTTTTTTTTCCCCTTCTTTTCCTCTGTG
GAGATCGAAACAAGTGGTGTTCTACCACTGAGCTACATCTCTAATTCTTAAAAAATTTAA
TAAGACTGGGTGGGGATTCAGAGCCTGGCCTCAAATCTCAGCCTCTTTTTTGTCACTGGG
ATGTGTGCCACTGTGGTCTGCTTTCAACTTCCATTTTTCTTTCTATTGTAATCAACATTG
TGCAGCTAGCTATTCTATTAAAATACACTGCATTGTACAGTAGCACTTGTGTGTGTTTTT
GTTAAACTTTTGGACAAAGACTTGTGGACAAGTGCAAAAAATAAATCCTCTTTTGCAACC
CAGAACTCATTGTTCAGTATGAGTTTTGATACATACAAGCAGGTATACTATCTACTATAG
CCTAAAATGATGTGATTTGATAAATGAAAAGGTTCTAAAATGAGAATCTCAGCTTTGTTG
ATTGCATGTTCCAATTTTCATATTGGGATTCAAGTAAAGGGCTTTTTTTTTTTTGAAGGC
TGTCTTCAGAAAATGATGCATTGGTTTGAAGATATTTTAACTGGTGTAAGTATATTAGAT
TAATTCATTTTAATGAGATACTTGTGGCTTTATTTAATTTTGAATTATGACATTGACTGC
CAGAAAACAATCTTGGATTCAAATATTTTATAGTGCTGAAGTACTAGTTTCATTTTACTT
GAAAGTTTTCTTGGGAAGTCTTAAAACATGGTTTCTCAATTCAAGTATACCTAAGAATCA
TTAAATTCATTAGACTGGTCTATTTAAGATGAAAAACATGTTAAGAACCAAACTTCTGCC
AGGCACATGTCTGTAATCCCAGTGGCTCTAGAGGCTGAAACAGGAGGATTCCAAGTTCAG
AGTTCGCTTCAGCAATAGCAAGGTACTAAGCAATTCAGTGAGACCCTGTCACTAAATTAA
AAAATACAACATAGGGCTGGGGGATGTTTAGTGCTCCTGAGTCAAATCCTCTGGTACTCC
CCCCAATCCCCCCTCAAAAAAACCTACTATAATTTATACTTAATCCTAAAAGTCACCTAC
TTGATGGTACTTTTGGCTCCTACATAGCTTGGTACAAATCCTTGCCATGTGACTATAATA
TTATTGCATTTGAGGTAATTTATAGATAATTAGAATTCTAGGACTTGCACATGGTAGACA
AGTGCATGTACTCCTATGCTATACCCTACCACTCTTGAAATTAGTTCCTTTTTCTTGATG
ACAATGAAAGTAGCTTTTATTTTTTTTTCATTATTTAACTATATCTACAATTCTGCATTC
AGATATTCTCGAGACTCATTTGCTTTCTTCTGGAGGCTATGCATTTATTTATCTAAACAC
GGGTTGAGTCTAATCCCGATGGGGCTTCCCTTGAACTCCCTCGCCCTTGCAACCCCTCCT
AGAATATGTCACGTGTCTAGCTTCCCATAGGACNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGCTATGTTATGAT
GATGGGCAATATGTTCAACTGCTCTGAATGGGCTGAATGAAAATAGCCTCTCTGAACATC
CAAATTTAAAATATACTATGTATTTTCCAAAATGGTTGTCTTTATAATGGTTAGTGATCA
GGGCATTTTGGGTTCTCTAAATGATTGGATGAAATGATGACCACATTTTAAATATAATTT
TTTTACAGGTGGAGAATTGTGAAATCATCTGGCAAGTAACCTTTTTTTTTAATTTATAAT
GTATTTTCCATGGTATAATGGTCATTACCAAGGCTTTTTGAATACAGTTTCTTATTTGCT
GTGGACATGACCATAAAATAATTCCCTCTAGGTTTTCTATCTGCTACTTTGCTAGCATTC
AACCCATTGGGAACATTCAATATACTTTTTTTTTGTCTATGTTGCCTAGACTTTTAAAAC
ATTCAGATTCTCACACACACTGTTTACACCAGTTTGGTGATATGGCTCCAGAACTCATTC
TTGATTGCTCTAATTCTCTATATCCTTATTATATTATAGGGCTCTTGAAACAAACAGATA
AGCATCAGATCGTCTAAAAAGGTATGTGTGTGTACTTGAGACCTATATATAACACAATGG
TCATTTCAAAGAGGGCTTTTGGGGCTGTGAAACCAGGAGCCCTTAACGCAGTGACCACAG
ATTGATGTTCTCCACAGGACCCCATAGTCACTCAGTAGTGCTGTATATTCCTGAGGAGAT
AACATTTATTTACCAACTTGTGATCATGATGATTGATAGATGTGGGAATGTTTAACCAAC
AATGTCTATGCTCTTTTTTAGGGTATTCTTGGAATGGACAACAAAGGAATCACAATGGAA
ATTCCTTAAATAAAAATTTATTGACTTAAAATTACACACTTTTAAAAGAAAAACACCATT
CTAAAGAAGAGTCAGCCTGTATTTTTGGCTCGAAGTTTCTCTAGTGTTTTCTGTGGAGAG
AATAAATAAAAAATAAGCAGCAGCAGTTCCTATTGTGATATGCGCTAAATGTAAGAAGGG
AGGAGGCTTGTTTACCTTATGAAATTCTTTTGCCCTTTCTCTGTTCTGGGCATAAGCTTC
TTGTTTTGCTTTCTCTACCTTTTGTTGTTTCACTTCAGCTAATTGATTATATAGTCTGAA
AGTAATTTAATTTATATGGAATTAAATACAATATTGAAGAAGAATGAGCTACTAAAAATA
AAGCAAAAAAAAAAAAGCTACCTTAGAGCCCTTTGGTGCATGAGGGTGTGTGCATTCTTT
CTTTCTTCTGGAAAATTCATTTTAACTTTATTGACTCCCTTAAGGCGACTCACAGATGAA
CCTGGGAAAAGGGAAATAAAGGCCAGATTTGCTAGGGCATAGGCAAAGCCCTGGTATGAC
AGTCGATTGATTATTCAAAGACAGCATACCTGTACACTGTTTCTCCTTAACTGTTTTGAT
TTGGGAATTTTCAGTGAGTTTGCTCTTATTCCTTATTTCTTTCTGCCTCTGGTAGGATCT
CTCCAAAAATGATTTTTTTCTCTTTACAAATGCTTCTTGTAAGCTTCCTGCCATGGTACA
TTTTGGCAGTGTTTCTATTTTAAGAAAGAGTTGGGGCCATGCTGAATTATTTAAGTATAT
AGCTTAAAAGGTGTGATCCCTAGACTCACCATTTCAGTTACTCAAGCCATTACCTGTAGA
TTCTGTTGACTTCTGCATAGAAAACTCTGATATGACTGGATGATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved