Spermophilus_tridecemlineatus Locus Poly:4:SNORD116
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:4:SNORD116
Spermophilus_tridecemlineatus
Poly:4:SNORD116
scaffold_86550
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1094, 2052..2145, 3128..3221, 4201..4294, 5271..5364
6099
CTGACCATATTTTTTCATTATTTTATGATTCTTTATGGTACTATATATGTTTATAGGAA
TTTATTTTTTGAGATTTTTCAGTGTCTTGTGTAAAATTGTCTATAATATTTTCTTCATTT
AGTTTATTTCTTTGGACTTCAGTTGAAATGTGTTTTTATTATATTTGTTATTTGAATTTG
CTTTTTGTGTATTTAGATAGGAGTTTGTCACATTTGTTGATNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGAGCAAGGTCTCCAGGTGTGTGGCCGTAGGCCCCAA
GGTGTACGATTCGGATTAAGCTCTGAGTATATCGGGGATGCAGGAGAGAGTATCCTGAGC
ATTGAGGATCATACTCAGCATACAGGATGGTGTCATGGGAGAGGAGAGCCGTGGCCCGGG
GCCTTTGTTCTCAGGGTTGCTAATCATCTGTGTGCACTCTTCAAGAAGAGGTGGCGGGCG
AGGGAGGCGTGCCTGAAGGAAAACCTGGAGCGTGCCCACCTGTGCTGAGACCGTGGGGTC
CTGTTTTCTGGTTGGCATCCCCGTGTTCGCGACTGGGACCCAGGCCGGAGCGTGGCGAAG
ACGGTAAGCTTGGTTTGTCCACCTGCACGGGTGCCAAGCCAGTTGTTGGAGGCTGTGAGG
GTTGGTGTGCAAGTACCGTCCCCGTGACGGTGCTCGTTCGGGCCCCGGCCCGGCCCGACC
CGGCCCGGGGCGTGGACGCGGTTGGTGCGTCCGGCGTGCTTGGATCGATGATGAGTCCTC
CAATAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAAAACCCACTACCGTCTCGCTCA
TCGTGACTGAGGTCCGGCACACTCTGGCAGAGGCAGAGGCAGAGGCAGAGGTGGCAGGGG
CCAGGGATGGCTGCCGGGGCTTCCCATACTTGTCCTCCTCACGGGCGAATTCCTAGGCCC
GGCCGATGCCCACAGCTGGGCTGTGGTCCCGCCCATGTGCGTGTGGCCGCTGGGTGTTCT
GGGCTGAGCCGAGTCAGGTGCTCGGAAGAGCCAGGCCTGCTGGGGCAACACCGGTGGGAG
GTGTCCAAGCGCCCTCTTTTAAAAGGTTGGGATGACTTGGAGGCACGAGGTTGCCTAGCC
CTGGCGCTCCCTTTCCTGATGGGACCAGTGGCTGAGGGTGCAGCATACGTTATCTCAGGG
GGCAGCGGGGTGGAGGGGAGGACAGGAACAAGGCGGAAGTGGAATGTTGCAGCAGGCAGA
GCCCTGGCGATGACTGCAAGGTGCGGAAAGTGAGGCCTGTAGCAAACTATGCTCCCAAGA
TGGCGCGCGCAAGGTCTCCGGGTGTGTGGCCGTAGGCCCCAGGTGTGCGATTCTGGATTA
GCTCTGAGTATATCGGGATGCAGGAGAGTGTATCCTGAGCATTGAGGATCTTACTCAGCC
TACAGGATGCTGGCATGGGAGAGGAGAGCCGTGGCCCGGGGCCTTTGTTCTCATGGTTGC
TTGTCATCTGTGTGCACTCTTCAGGACGAGGTGGCGGGCGAGGGAGGCGTGCCTGGTGGC
TGACCTGGAGCGTGCCCACCTGTGCTGAGGCCGTGGGGTCCTGTTTTCTGGTTGGCATCC
CCGTGTTCGCGACTGGGACCCAGGCCGGGGCGTGGCGAAGACGGTAAGCTTGGTTTGTCC
ACCTGCACGGGTGCCAAGCCAGTTGTTGGAGGATATGCAGGATTTGGCGTGGCCATAGCG
CCCCCTAAATGAGCTCGGTCGGGCCCGGGCCCGGCCAGGGGCGTGGACGCGGTTGGTGCG
TCCGGCGTGCTTGGATCGATGATGAGTCCTCCAATAACATTCCTTGGAAAAGCTGAACAA
AATGAGTGAAAACCCACTACCGTCTCGCTCATCGTGACTGAGGTCCGGCACACTCTGGCA
GAGGCAGAGGCAGAGGCAGAGGTGGCAGGGGCCAGGGATGGCTGCCGCGGCTTCCCATAC
TTGTCCTCCTCACGGGCGAATTCCTAGGCGCGGCCGGTGCCCACGGCTGGGTTTGTGGTC
CCGTCAGTGTGCGTGGGGCCGCTGGGGGTTCTTGGCTGAGCGGAACCACATGCTCAGCAG
AGCCAGGCCTGCTGGAGAACAACAGGTGTGAGGTGTCCAAGCGCCCTCCTTAAAAGGTTG
GGATGACTTGGAGGCATGAGGTCGCCTGGAGAGGGCCAGCCCTGGCCCTCCCTTTGTTAG
AGGACCAGTGGGTGAGGGTGTAGCAGACCTTCTGGCATCGGGCAGCGGGGTGGAGTGTGG
AGGGTGGAGGGGAGGACAGGTAGAAGGAGGATGGGGAAAATTGCAGCAGGCATACCCCTG
GTGAAGCCTAGAAGGTGCGGAAAGCGAGGCCTGCAGCAAACTATGCTCCCAATATGGCGG
GCCCAGGTTCCCCGTGTGTGCGGAAGTAGCCCCCGGGTGCGGGATCGTGGATCCGCTCCC
TGTGGATTGGGGATGCAGGACAGTGTATGGTGAGCCTTGGGGAGTATACTCAGCCGACAG
GAAGCTGGCATGGGAAGGGAGAGCCCTGGCACCGGGGCCTTTGTTCTCATGGTTGCTTGT
CATCTGTGTGCACTCTTCAGGACGAGGTGGCGGGCGAGGGAGGCGTGCCTGGTGGCTGAC
CTGGAGCGTGCCCACCTGTGCTGAGGCCGTGGGGTCCTGTTTTCTGGTTGGCATCCCCGT
GTTCGCGACTGGGACCCAGGCCGGGGCGTGGCGAAGACGGTAAGCTTGGTTTGTCCACCT
GCACGGGTGCCAAGCCAGTTGTTGGAGGATATGCAGGATTTGGCGTGGCCATAGCGCCCC
CTAAATGAGCTCGGTCGGGCCCGGGCCCGGCCAGGGGCGTGGACGCGGTTGGTGCGTCCG
GCGTGCTTGGATCGATGATGAGTCCTCCAATAACATTCCTTGGAAAAGCTGAACAAAATG
AGTGAAAACCCACTACCGTCTCGCTCATCGTGACTGAGGTCCGGCACACTCTGGCAGAGG
CAGAGGCAGAGGCAGAGGTGGCAGGGGCCAGGGATGGCTGCCGGGGCTTCCCATACTTGT
CCTCCTCACGGGCGAATTCCTAGGCCCGGCCGATGCCCACAGCTGGGCTGTGGTCCCGCC
CATGTGCGTGTGGCCGCTGGGTGTTCTGGGCTGAGCCGAGTCAGGTGCTCGGAACAGCCA
GGCCTGCTGGGGCAACACCGGTGGGAGGTGTCCAAGCGCCCTCTTTTAAAAGGTTGGGAT
GACTTGGAGGCACGAGGTTGCCTAGCCCTGGCGCTCCCTTTCCTGATGGGACCAGTGGGT
GAGGGTGTAGCAGACCTTCTGGCATCGGGCAGCGGGGTGGAGTGTGGAGGGTGGAGGGGA
GGACAGGTAGAAGGAGGATGGGGAAAATTGCAGCAGGCATACCCCTGGTGAAGCCTAGAA
GGTGCGGAAAGCGAGGCCTGCAGCAAACTATGCTCCCAAGATGGCGGGCCCAGGTTCCCC
GTGTGTGCGGAAGTAGCCCCCGGGTGCGGGATGGTGGATCCGCTCCCTGTGGATTGGGGA
TGCAGGACAGTGTACGGTGAGCCTTGGGGAGTATACTCAGCCGACAGGAAGCTGGCATGG
GAAGGGAGAGCCCTGGCACCGGGCCATTGTTCTCATGGTTGCTTGTCACTTGTGTACACT
CTTCAGGACAAGGTGGCGGGCGAGGGAGGCGTGCCTGGTGGCTGAGTGGAGCGTGCCCAC
GTGTGCTGATGCCGTGGGGTCCTGTTTGTTGTTTGGCATCCCCGTGTTCGCGACTGGGAC
CCAGGCCGGAGCGTGGCGAAGACGGTAAGCTTGGCTTGTCCACCTCCCCCGTGCCGAGCC
AGTTGTTGGAGGCTGTGAGGGTTGGTGTGCAAGTACCGTCCCCGTGACGGTGCTCGTTCG
GGCCCCGGCCCGGCCCGACCCGGCCCGGGGCGTGGACGCGGTTGGTGCGTCCGGCGTGCT
TGGATCGATGATGAGTCCTCCAATAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAAA
ACCCACTACCGTCTCGCTCATCGTGACTGAGGTCCGGCACACTCTGGCAGAGGCAGAGGC
AGAGGCAGAGGTGGCAGGGGCCAGGGATGGCTGCCGGGGCTTCCCATACTTGTCCTCCTC
ACGGGCGAATTCCTAGGCCCGGCCGATGCCCACAGCTGGGCTGTGGTCCCGCCCATGTGC
GTGTGGCCGCTGGGTGTTCTGGGCTGAGCCGAGTCAGGTGCTCGGAAGAGCCAGGCCTGC
TGGGGCAACACCGGTGGGAGGTGTCCAAGCGCCCTCTTTTAAAAGGTTGGGATGACTTGG
AGGCACGAGGTTGCCTGTAGGCACGAGGTTGCCTAGCCCTGGCGCTCCCTTTCCTGATGG
GACCAGTGGCTGAGGGTGCAGCATACGTTATCTCAGGGGGCAGCGGGGTGGAGGGGAGGA
CAGGAACAAGGCGGAAGTGGAATGTTGCAGCAGGCAGAGCCCTGGCGATGACTGCAAGGT
GCGGAAAGCGAGGCCTGTAGCAAACTATGCTCCCAAGATGGCGCGCGCAAGGTCTCCGGG
TGTGTGGCCGTAGGCCCCAGGTGTGCGATTCTGGATTAGCTCTGAGTATATCGGGGATGC
AGGAGAGTGTATCCTGAGCATTGAGGATCTTACTCAGCCTACAGGATGCTGGCATGGGAG
AGGAGAGCCGTGGCCCGGGGCCTTTGTTCTCATGGTTGCTTGTCATCTGTGTGCACTCTT
CAGGACGAGGTGGCGGGCGAGGGAGGCGTGCCTGGTGGCTGACCTGGAGCGTGCCCACCT
GTGCTGAGGCCGTGGGGTCCTGTTTTCTGGTTGGCATCCCCGTGTTCGCGACTGGGACCC
AGGCCGGGGCGTGGCGAAGACGGTAAGCTTGGTTTGTCCACCTGCACGGGTGCCAAGCCA
GTTGTTGGAGGATATGCAGGATTTGGCGTGGCCATAGCGCCCCCTAAATGAGCTCGGTCG
GGCCCGGGCCCGGCCAGGGGCGTGGACGCGGTTGGTGCGTCCGGCGTGCTTGGATCGATG
ATGAGTCCTCCAATAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAAAACCCACTACC
GTCTCGCTCATCGTGACTGAGGTCCGGCACACTCTGGCAGAGGCAGAGGCAGAGGCAGAG
GTGGCAGGGGCCAGGGATGGCTGCCGCGGCTTCCCATACTTGTCCTCCTCACGGGCGAAT
TCCTAGGCGCGGCCGGTGCCCACGGCTGGGTTTGTGGTCCCGTCAGTGTGCGTGGGGCCG
CTGGGTGTTCTTGGCTGAGCGGAACCACATGCTCAGCAGAGCCAGGCCTGCTGGAGAACA
ACAGGTGTGAGGTGTCCAAGCGCCCTCCTTAAAAGGTTGGGATGACTTGGAGGCATGAGG
TCGCCTGGAGAGGGCCAGCCCTGGCCCTCCCTTTGTTAGAGGACCAGTGGGTGAGGGTGT
AGCAGACCTTCTGGCATCGGGCAGCGGGGTGGAGTGTGGAGGGTGGAGGGGAGGACAGGT
AGAAGGAGGATGGGGAAAATTGCAGCAGGCATACCCCTGGTGAAGCCTAGAAGGTGCGGA
AAGCGAGGCCTGCAGCAAACTATGCTCCCAAGATGGCGGGCCCAGGTTCCCCGTGTGTGC
GGAAGTAGCCCCCGGGTGCGGGATCGTGGATCCGCTCCCTGTGGATTGGGGATGCAGGAC
AGTGTATGGTGAGCCTTGGGGAGTATACTCAGCCGACAGGAAGCTGGCATGGGAAGGGAG
AGCCCTGGCACCGGGCCATTGTTCTCATGGTTGCTTGTCACTTGTGTACACTCTTCAGGA
CAAGGTGGCGGGCGAGGGAGGCGTGCCTGGTGGCTGAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved