Spermophilus_tridecemlineatus Locus Poly:0:SNORD116
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:0:SNORD116
Spermophilus_tridecemlineatus
Poly:0:SNORD116
scaffold_98896
SNORD116, SNORD116, SNORD116, SNORD116
1001..1092, 2822..2913, 4645..4736, 6468..6559
7559
GGGCATCAGAAGTGCTTCAGGAAAGAGCCTTAGTATCGTTGTGTGCTTTCGGTGCGCCC
GTGAGGCCGCATGCATGGTGGTCGATGTGCGTCCTGAGAGAGCCCATACGCGCTTTGGAT
CCCGAATGAGCCACCGTGGTGGCAGACCTCAGGGATGACTTCTCTTGTAGGAGGCGCATG
TGAACCCGAGACGTCAGCGTCTCGTTTTTGAGCGTAGGACAGCCGTGAATGGTTTGGGTA
GTGGAAAGGCCTAACTGGGTCCAAAGTCATTCGTAAGGATTGTTGCCTGTGCCTGAAGGA
AGTAGAGAGTGATGAAATTCACCTCTTTGCCAAGTGCCTTTCATAGGCGCTGGACAGGCG
TTGAGGGTCTCCTCTCCTGCACAAGTTGTGGGGTTCAGGCATTGGAACGTATGGGTGGGG
CTGGAGCTCCTGTTGGAATCCATGTCACGTGGGGCTCCCAGATGCCCGTGGCGATGGCCC
AGAAAGGCAGGAGCTTTGCAGAGGACGTACTTTCTCAGGTTCGTCCTTTCTTGCTTGGAC
ATCCTGTGGAGGGAAGGAGTCAGGGTGAGATTGGTTTGTAGAGTTGGATGGAGATTCTCA
GATGGCTTTCCCGTTGTGGGAAGAGTTTGTTGGGCAGCTTAAGAGCCACATGGGAACTGA
GCTCAGGCCGGCATGGCGTGGGCAACTGAAAAGGCTGCCGTCCCTAAAGAGTGTGAACTG
AGGAGCAGCAGGCTGCGGAGCAGGCCAGTCATGGTGATTTTTCACGGGCCTCCCTCTCTT
TTGTCTCCTTGCATACGCACGGCAGGTCGTGTTTCCACGGAAGGATTGAAAGGTTGCCGC
CGGCTCCTCTGGCTGTGGGAAGATGCCCAGGGAGGACGGGGAGCGCCCGCCTGCGCGTGC
CCTCTGTTTCCTGAGTGTGGCCCTTCGTAGCTGACGATGGTAAGCGTCCCCTCGCCCCAG
GTCACCGAGGTTGCTCCTTGCCAGGTGAGGGTCACAAGCGTGGATCGATGATGACTCCCA
CAAAAACATTCCTTGGAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCTCTCTCATC
GAAACTGAGGTCCACCACGTAGACGTAGGGGGCTGCAGTGAGCTGGGTGGTGGAGGGGAG
AACCCTGTGGCCCTTTTTCGACGGGGGCCGTGTCGGAATGGACCCTGGAAGGGAAGGCCC
CTTTCTGCCGAGTTCACCTGGCGTTAGGACCCCGAGCCCGTGGTCCTCTGAGTGTCAGTC
CTCCTTTGGTTTCGGCATGCATGGGTGATCCAGAGCTCAAGGCCTGGGGGAAGACGTTGG
CCTGCCCGGGAAGATTTCCTAGTGGGTGTTCGGCGGTAGGGTTCAGCCGTACTAGGGGGT
TCTGGGCCGTGGCACAGGAGGATAACTCTCCTCCTCTTGTGCACTGGAGACGTTTTTGCC
AAGGCGAGTCGCGCCGTGCTGGTCTGCTGGGTGTCCCAGAGAAAACTGAGGTCCACGTTC
ATCGGGGGCCGGAGGCAGGCCCAGCGCAAAGCAGGGGAGACCCTTCTTTAGTGCACAGGG
GCGTGGTGTTTCCGGGAGTCTGATGGGTTTTCTCTTTTCCTGGAGATGCTTCAGTGTTGC
CAGTGGTATTGCCACACAATGTTGGCAGGAGCCATGGTCCACCAGGGGAAGGAAGGGTGG
GTCTCCAGAGGGACCAGTGCCTGGATGAGTAGATGGACATAGAGGGAATGCAAATGGAGG
AACTGGGTCTTCCCACAAGCGGGTACTTTTGCTGCCACTTGTGTTAATGGATCCCCCTGA
TAGATGGTTGGCTCTCGAGTTGGGGCATCAGAAGTGCTTCAGGAAAGAGCCTTAGTATCG
TTGTGTGCTTTCGGTGCGCCCGTGAGGCCGCATGCATGGTGGTCGATGTGCGTCCTGAGA
GAGCCCATACGCGCTTTGGATCCCGAATGAGCCACCGTGGTGGCAGACCTCAGGGATGTC
TTCTCTTGTAGGAGGCGCATGTGAACCCGAGACGTCAGCGTCTCGTTTTTGAGCGTAGGA
CAGCCGTGAATGGTTTGGGTAGTGGAAAGGCCTAACTGGGTCCAAAGTCATTCGTAAGGA
TTGTTGCCTGTGCCTGAAGGAAGTAGAGAGTGATGAAATTCACCTCTTTGCCAAGTGCCT
TTCATAGGCGCTGGACAGGCGTTGAGGGTCTCCTCTCCTGCACAAGTTGTGGGGTTCAGG
CATTGGAACGTATGGGTGGGGCTGGAGCTCCTGTTGGAATCCATGTCACTTGGGGCTCCC
AGATGCCCGTGGCGATGGCCCAGAAAGGCAGAAGCTTTGCAGACGACGTACTTTCTCAGG
TTCGTCCTTTCTTGCTTGGACATCCTGTGGAGGGAAGGAGTCAGGGTGAGATTGGTTTGT
AGAGTTGGATGGAGATTCTCAGATGGCTTTCCTGTTGTGGGAAGAGTTTGTTGGGCAGCT
TAAGAGCCACATGGGAACTGAGCTCAGGCCGGCATGGCGTGGGCAACTGAAAAGGCTGCC
GTCCCTAAAGAGTGTGAACTGAGGAGCAGCAGGCTGCGGAGCAGGCCAGTCATGGTGATT
TTTCACGGGCCTCCCTCTCTTTTGTCTCCTTGCATACGCACGGCAGGTCGTGTTTCCACG
GAAGGATTTTAAGGTTGCCGCCGGCTCCTCTGGCTGTGGGAAGATGCCCAGGGAGGACGG
GGAGCGCCCGCCTGCGCGTGCCCTCTGTTTCCTGAGTGTGGCCCTTCGTAGCTGATGATG
GTAAGCGTCCCCTCGCCCCAGGTCACCGAGGTTGCTCCTTGCCAGGTGAGGGTCACAAGC
GTGGATCGATGATGACTCCCACAAAAACATTCCTTGGAAGCTGAACAAAATGAGTGAAAA
CTCTATACCGTCTCTCTCATCGAAACTGAGGTCCACCACGTAGACGTAGGGGGCTGCAGT
GAGCTGGGTGGTGGAGGGGAGAACCCTGTGGCCCTTTTTCGACGGGGGCCGTGTCGGAAT
GGACCCTGGAAGGGAAGGCCCCTTTCTGCCGAGTTCACCTGGCGTTAGGACCCCGAGCCC
GTGGTCCTCTGAGTGTCAGTCCTCCTTTGGTTTCGGCATGCATGGGTGATCCAGAGCTCA
AGGCCTGGGGGAAGACGTTGGCCTGCCCGGGAAGATTTCCTAGTGGGTGTTCGGCGGTAG
GGTTCAGCCGTACTAGGGGGTTCTGGGCCGTGGCACAGGAGGATAACTCTCCTCCTCTTG
TGCACTGGAGACGTTTTTGCCAAGGCGAGTCGCGCCGTGCTGGTCTGCTGGGTGTCCCAG
AGAAAACTGAGGTCCACGTTCATCGGGGGCCGGAGGCAGGCCCAGCGCAAAGCAGGGGAG
ACCCTTCTTTAGTGCACAGGGGCGTGGTGTTTCCGGGAGTCTGATGGGTTTTCTCTTTTC
CTGGAGATGCTTCAGTGTTGCCAGTGGTATTGCCACACAATGTTGGCAGGAGCCATGGTC
CACCAGGGGAAGGAAGGGTGGGTCTCCAGAGGGACCAGTGCCTGGATGAGAGTAGATGGA
CATAGAGGGAATGCAAATGGAGGAACTGGGTCTTCCCACAAGCGGGTACTTTTGCTGCCA
CTTGTGTTAATGGATCCCCCTGATAGATGGTTGGCTCTCGAGTTGGGGCATCAGAAGTGC
TTCAGGAAAGAGCCTTAGTATCCTTGTGTGCTTTCGGTGCGCCCGTGAGGCCGCATGCAT
GGTGGTCGATGTGCGTCCTGAGAGAGCCCATACGCGCTTTGGATCCCGAATGAGCCACCG
TGGTGGCAGACCTCAGGGATGACTTCTCTTGTAGGAGGCGCATGTGAACCCGAGACGTCA
GCGTCTCGTTTTTGAGCGTAGGACAGCCATGAATGGTTTGGGTAGTGGAAAGGCCTAACT
GGGTCCAAAGTCATTCGTAAGGATTGTTGCCTGTGCCTGAAGGAAGTAGAGAGTGATGAA
ATTCACCTTTTTGCCAAGTGCCTTTCATAGGCGCTGGACAGGCGTTGAGGGTCTCCTCTC
CTGCACAAGTTGTGGGGTTCAGGCATTGGAACGTATGGGTGGGGCTGGAGCTCCTGTTGG
AATCCATGTCACGTGGGGCTCCCAGATGCCCGTGGCGATGGCCCAGAAAGGCAGGAGCTT
TGCAGAGGACGTACTTTCTCAGGTTCGTCCTTTCTTGCTTGGACATCCTGTGGAGGGAAG
GAGTCAGGGTGAGATTGGTTTGTAGAGTTGGATGGAGATTCTCAGATGGCTTTCCTGTTG
TGGGAAGAGTTTGTTGGGCAGCTTAAGAGCCACATGGGAACTGAGCTCAGGCCGGCATGG
CGTGGGCAACTGAAAAGGCTGCCGTCCCTAAAGAGTGTGAACTGAGGAGCAGCAGGCTGT
GGAGCAGGCCAGTCATGGTGATTTTTCACGGGCCTCCCTCTCTTTTGTCTCCTTGCATAC
GCACGGCAGGTCGTGTTTCCACGGAAGGATTGAAAGGTTGCCGCCGGCTCCTCTGGCTGT
GGGAAGATGCCCAGGGAAGACGGGGAGCGCCCGCCTGCGCGTGCCCTCTGTTTCCTGAGT
GTGGCCCTTCGTAGCTGACGATGGTAAGCGTCCCCTCGCCCCAGGTCACCGAGGTTGCTC
CTTGCCAGGTGAGGGTCACAAGCGTGGATCGATGATGACTCCCACAAAAACATTCCTTGG
AAGCTGAACAAAATGAGTGAAAACTCTATACCGTCTCTCTCATCGAAACTGAGGTCCACC
ACGTAGACGTAGGGGGCTGCAGTGAGCTGGGTGGTGGAGGGGAGAACCCTGTGGCCCTTT
TTCGACGGGGGCCGTGTCGGAATGGACCCTGGAAGGGAAGGCCCCTTTCTGCCGAGTTCA
CCTGGCGTTAGGACCCCGAGCCCGTGGTCCTCTGAGTGTCAGTCCTCTTTTGGTTTGGGC
ATGCATGGGTGATCCAGAGCTCAAGGCCTGGGGGAAGACGTTGGCCTGCCCGGGAAGATT
TCCTAGTCGGTGTTCGGCGGTAGGGTTCAGCCGTACTAGGGGGTTCTGGGCCGTGGCACA
GGAGGATAACTCTCCTCCTCTTGTGCACTGGAGACGTTTTTGCCAAGGCGAGTCGCGCCG
TGCTGGTCTGCTGGGTGTCCCAGAGAAAACTGAGGTCCACGTTCATCGGGGGCCGGAGGC
AGGCCCAGCGCAAAGCAGGGGAGACCCTTCTTTAGTGCACAGGGGCGTGGTGTTTCCGGG
AGTCTGATGGGTTTTCTCTTTTCCTGGAGATGCTTCAGTGTTGCCAGTGGTATTGCCACA
CAATGTTGGCTGGAGCCATGGTCCACCAGGGGAAGGAAGGGTGGGTCTCCAGAGGGACCA
GTGCCTGGATGAGAGTAGATGGACATAGAGGGAATGCAAATGGAGGAACTGGGTCTTCCC
ACAAGCGGGTACTTTTGCTGCCACTTGTGTTAATGGATCCCCCTGATAGATGGTTGGCTC
TCGAGTTGGGGCATCAGAAGTGCTTCAGGAAAGAGCCTTAGTATCCTTGTGTGCTTTCGG
TGCGCCCGTGAGGCCGCATGCATGGTGGTCGATGTGCGTCCTGAGAGAGCCCATACGCGC
TTTGGATCCCGAATGAGCCACCGTGGTGGCAGACCTCAGGGATGTCTTCTCTTGTAGGAG
GCGCATGTGAACCCGAGACGTCAGCGTCTCGTTTTTGAGTGTAGGACAGCCGTGAATGGT
TTGGGTAGTGGAAAGGCCTAACTGGGTCCAAAGTCATTCGTAAGGATTGTTGCCTGTGCC
TGAAGGAAGTAGAGAGTGATGAAATTCACCTCTTTGCCAAGTGCCTTTCATAGGCGCTGG
ACAGGCGTTGAGGGTCTCCTCTCCTGCACAAGTTGTGGGGTTCAGGCATTGGAACGTATG
GGTGGGGCTGGAGCTCCTGTTGGAATCCATGTCACGTGGGGCTCCCAGATGCCCGTGGCG
ATGGCCCAGAAAGGCAGGAGCTTTGCAGAGGACGTACTTTCTCAGGTTCGTCCTTTCTTG
CTTGGACATCCTGTGGAGGGAAGGAGTCAGGGTGAGATTGGTTTGTAGAGTTGGATGGAG
ATTCTCAGATGGCTTTCCTGTTGTGGGAAGAGTTTGTTGGGCAGCTTAAGAGCCACATGG
GAACTGAGCTCAGGCCGGCATGGCGTGGGCAACTGAAAAGGCTGCCGTCCCTAAAGAGTG
TGAACTGAGGAGCAGCAGGCTGCGGAGCAGGCCAGTCATGGTGATTTTTCACGGGCCTCC
CTCTCTTTTGTCTCCTTGCATACGCACGGCAGGTCGTGTTTCCACGGAAGGATTGAAAGG
TTGCCGCCGGCTCCTCTGGCTGTGGGAAGATGCCCAGGGAGGACGGGGAGCGCCCGCCTG
CGCGTGCCCTCTGTTTCCTGAGTGTGGCCCTTCGTAGCTGACGATGGTAAGCGTCCCCTC
GCCCCAGGTCACCGAGGTTGCTCCTTGCCAGGTGAGGGTCACAAGCGTGGATCGATGATG
ACTCCCACAAAAACATTCCTTGGAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCTC
TCTCATCGAAACTGAGGTCCACCACGTAGACGTAGGGGGCTGCAGTGAGCTGGGTGGTGG
AGGGGAGAACCCTGTGGCCCTTTTTCGACGGGGGCCGTGTCGGAATGGACCCTGGAAGGG
AAGGCCCCTTTCTGCCGAGTTCACCTGGCGTTAGGACCCCGAGCCCGTGGTCCTCTGAGT
GTCAGTCCTCCTTTGGTTTCGGCATGCATGGGTGATCCAGAGCTCAAGGCCTGGGGGAAG
ACGTTGGCCTGCCCGGGAAGATTTCCTAGTGGGTGTTCGGCGGTAGGGTTCAGCCGTACT
AGGGGGTTCTGGGCCGTGGCACAGGAGGATAACTCTCCTCCTCTTGTGCACTGGAGACGT
TTTTGCCAAGGCGAGTCGCGCCGTGCTGGTCTGCTGGGTGTCCCAGAGAAAACTGAGGTC
CACTTTCATCGGGGGCCGGAGCCAGGCCCAGCGCAAAGCAGGGGAGACCCTTCTTTAGTG
CACAGGGGCGTGGTGTTTCCGGGAGTCTGATGGGTTTTCTCTTTTCCTGGAGATGCTTCA
GTGTTGCCAGTGGTATTGCCACACAATGTTGGCTGGAGCCATGGTCCACCAGGGGAAGGA
AGGGTGGGTCTCCAGAGGGACCAGTGCCTGGATGAGAGTAGATGGACATAGAGGGAATGC
AAATGGAGGAACTGGGTCTTCCCACAAGCGGGTACTTTTGCTGCCACTTGTGTTAATGGA
TCCCCCTGATAGATGGTTGGCTCTCGAGTTGGGGCATCAGAAGTGCTTCAGGAAAGAGCC
TTAGTATCGTTGTGTGCTTTCGGTGCGCCCGTGAGGCCGCATGCATGGTGGTCGATGTGC
GTCCTGAGAGAGCCCATAGGCGCTTTGGATCCCAAATGAGCCACCGTGGTGGCAGACCTC
AGGGATGACTTCTCTTGTAGGAGGCGCATGTGAACCCGAGACGTCAGCGTCTCGTTTTTG
AGCGTAGGACAGCCGTGAATGGTTTGGGTAGTGGAAAGGCCTAACTGGGTCCAAAGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved