Spermophilus_tridecemlineatus Locus Mono:179:SNORA9
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:179:SNORA9
Spermophilus_tridecemlineatus
Mono:179:SNORA9
GeneScaffold_2570
SNORA9
1001..1132
2132
CACGGCGTCTGGGGCTACGTAAGGACGTCAAGGCGCGTGGTGGCGTGCACGGCAGTATT
TGTGCCTGGTGATCCGGTTCTTGGTCTTTGCGATCCCTTCCTCGGTCCCTTCAGTATCCG
CTGCCATCGAAGACCCAGGCAGCTTGCGCTCTTTGATGAGGCCGGGTTAAGAGTCTTGGG
GTCGCTGTTCACGCGGAAGGAGGCCGGGCACTACCCACAAGTGCTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGGGACCTGTGACCTCGTGGGAGACCACTCAAAAGA
TGCTGTAGAGAGGTTCAGCATTTGGGGATTACAGCTGTATGGTGGCCTAAAGGCGCAAAC
TGAAACTTCATTTGTCCACATCTAGGCAGGAGTCGTGATCAGATGACCGATCCCACAAAG
TGGGAAAAGAGCTTACATCCACAGCAGCTCTTCAGGAAGATGTCATGGTAAGTCATGTTG
TGAATAGCCCAGCTTCGCCAAGGCTCACATTTCTCTGAGTAATTAAGTGTTCCTGAGGTG
TCTTAGGCTATATCCTAACTCAGAAATGTTTTCCAAGATATTAAATATGTGTTGAATATA
TATATAGGGGTGGGGAAAACCTGTTTTTCTAGAATTAGGTGATACGTGGGTTATTTCTGT
GGTCATGATTTTAAGAAGCACCACCCTAGATAGAGAATAATGTAAAAACTACTGCTGGTG
TATTAATTAACATTACCTTTTCCAAGATGCATTAATTCCTTAGCCATAAAAGAACATTCG
CTAGAGTTATCTGTAGCCATAGACTTTTGGAGCCAAGCTCAGTGTACCTAATTCGACTCG
ATAGTCTGTTCTGTTCTCTACCTTTGAAAGGGATTTGGGTGCTCAGGAGAGTGTCCTAAG
GGACACTTGGGGAGTGGAGGATGTGGGCCAGCGAATGTGAGTAGCAAGCCTCCAGCGTGC
TTGGGTCTGCAGTGACCCTATTGCATTCCTACAGTGCTTGCCAGAATACTTGAAATGGTT
TGAGGCCTTGCCCTGCCCTATCCAGAGCAAGGTTATAGAAATTTCAGACAACTGACTGCA
CCTTTCCAGATAATGGTATGCTATGCTGAGCATTGTATAGATCTTCATAGTCTAATGTTG
CAGCCACTTGACATATACACATATAGTTAAAGTAAATAAGATGTAAAATCCACTTTCTAG
TTTAGACTAGTATGGCAGGTGACTGTTGGACTACAGATTAGAGAACATTTTTGTCTTTAT
GGGAGTTTGGGAGAGGGTGGCAAAAGATAGTGAAGTCATTGAATATTTAAAGTTGAAAAT
GCAAGTTCAGGGGTAATAAAGGTAGGAGTTAAACCAGAATAGCAAAGAGTAACAGAAGAA
TCCTGCCTTGAGAGATTAGTGGAAGACAAAGCCAAGAAAACCAAGGACTCAGCTCAGCAA
AGGTACTGAGTGCCAGGGAGTTGTTGGAGGGTTAAAAGAGTGTGTATCAATCCTAAAGGA
AGGCCTCATAGAACATGTATGTACAGGTACCTTCTGACTGCCCTTTTGTGTCATGTAGGG
ACTGGGGCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGTGGGG
GTCGATAGGCCGCCCTGGGCCCTGCAGTTGAAAACAATAAAAAGACCTTGGCCAAAACCT
CGGGATTTTGTTTTAAACTGGCAGGCTACCTTGTTAGCTGCAAGGAGGAGCATCATAGAC
GTTCCAGTTCCTAACAACTACTACTTCCTGTGTCTCTGGCCCAGCATGTAGCAGAAGGCT
ATCTGCTGTTCCTTGGTGTTTCAGCAGCAGTGATCCCAGGATGCCAGAGCTGAATCCCTT
CTGTAGCTACTAGGCTAGTCTGTGGCGCCTGTGCAGTGTAAGTACACTATCAACTCTGAC
CTTCTTGTTACAAGTCAGATGTTTGAGTCCCAGATAGGTTAATTGTCTTTTATTTCACAG
GACTGGGGACAACTGTCTAATGTCTGACTTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved