Spermophilus_tridecemlineatus Locus Mono:158:SNORD14
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:158:SNORD14
Spermophilus_tridecemlineatus
Mono:158:SNORD14
GeneScaffold_5398
SNORD14
1001..1092
2092
TCTGACCTAACACATCTGGCTATCTCCAGGTATGATGTCTGCAAAACTTGACTTAAGGC
TATCTCACAGTCTATTAGTGTATTCTAACACAGAACCATAAAGGGACAGGGAATCTGGAA
ATCCTAGTTCCAACAATTCTCCCCAGCCCATAACTCAATCCAGAAAAAGTTCTCCCACCC
TAGGTTTTTATTGTCCTTCCTCCTTTAACCCAAAGTCAATCATCCATCTAACAGAAAAAA
TAACAGAGTAAAGGGTAACAGATTAAATTCACACAGAACTTATAATAAACTTGACATATT
TACAAATTAATGCCAATTATTTATTAGCAATGAGAAGAGAATGAACTTCACTATACCAAT
TTTTTCCCCATAATAAAGAAGGGTAGAAAGTATATGATAGAAAAGGGATATCCCAAATCT
GCCAATTCAGTGACAAAACTCTCAATAATTGTGGGCACAGTGGTGCATGCCTGTAGTCCC
AGCTACTCAGAAGTCTAAGGCTGGAGGAACCCTTGAACCCAAGAGTTTGAAGACCAGCCT
GAATGATATAACAAGACCCTGATTCAACAAACACCAAAATACCTGACAAAACACTCAACT
ATTAACAAAGACTAATTTTTCAATGTCCCATTAACCACAGAATAATTTAAAACTATATAA
AAAAAATCAGATCTACTGCATAATAGAACTACATCTCAATTCATTCAGGAATCTTACAAA
CTTACATATATAAAATGAATGAGAAAAAAAATTATTAACTGGCATAAGAGAAAAAAAATA
CCTATTGAACTCATTAATTCAAGGGTACTTACAGAATTATCTCAGTTCAACATTTCTTTG
TGAGAATAAGATTTTGAAATCCATAGCAGAGAGATCTACTTTAAGAGAAAGTCACTGATA
AAGATTATTAATAAAGGTACAGCTTTTATAACATTTCCTTCAAATTATGATTTCTGGTGA
GCAATATACCCAAATTAGTTTGTATCAAGCATTTTATATTTCTTTGATACATATAATTTC
AAAACATTGGTAGTTTCCACAAAAATCTTGGAAATGCTTGTTAAATTGAAATATTCCTTG
GTTGGTTTAGTTTTTTCAGTGTTGGGGATCAAACTCAGGGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGGATTAAAAGCTTTTCCAAACTCCATTCATAGTAGTTC
TCTACACATGCATTCTTGTGTGTGTTAGAAAGGCTGTGAGATTATCAGCTTTCCTGCATT
CCTTAGGTAGGATTTCTCCTCAGGATCAGTTCTTTCATTCTTACAAAAGGAACTGGGACA
AGAGAATATTTTCCAACATCCCTTACATCCACAGGGTGTCTGTACAGTATTAAATTCATT
ACGTATTCATGACTGAAACAACAGAAGACTTTATCACGTCTTATACTTGTACAATTATTC
TTTGCTATGAGTCTTTCCATGTTTATACAAGGAATTTTGACACCTGAAGGCTTTCCCACA
TTCATTACATTCATAAGGTTTCTCTCCAGTATGAATTTTTTCATGTCTTCGAAAGGAATT
AGAACTACTTAAGCCTTTCCCACACTGCTTACATTCATAGGGTTTCTCTCCAGTGTGAGT
TCTTTCATGTATTCTAACATAACTGGAACTACTGAAGGCTTTCCCACATTGCTTACATTT
ATAAGGTCTCTCTCCACTGTGTATTATCATGTGTCTTCGAACACTTTTGAGACAAGTGAA
TATTTTCCCACATTCCTCACATTCATAAGGTTTCTCTCCAGCATGTGTTCTTACATGCAT
TCGAATGTAACTGGGACAACTGAAGGCTTTCCCACACTGCTTACATTCATAGGGTTTCTC
ACCAGAGTGAGTTGTTTCATGATTTCGAACAGAACTGGGACACTTAAAGGCTTTACCACA
TTGTTTACATTCATAGGGTTTCTCTCCAGTGTGTGTTCTTTCATGTATACGAAATAAACT
GGGATAATGAAATGTTTTCCCACATACCTCACATTTATATGGTCCATCTCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved