Spermophilus_tridecemlineatus Locus Mono:150:SNORD28
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:150:SNORD28
Spermophilus_tridecemlineatus
Mono:150:SNORD28
GeneScaffold_5435
SNORD28
1001..1074
2074
CTTAATAGATACATAAAAGGCATTTGACCATATTCAGCATCCATTCATGCTCAAAACAC
TAGAAAAATTATGGATAGTAGGAACATACCTCAACATTGTAAAAGCTACATTTACACTAA
ACCCAAGCCAACATCATTCTAAATGGAGAAAAATTGAAAACATTCCCTCTAAGAACTGGA
TCACGTGTCCTCTTATTTCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTTTTGTGTGGGTGTGGGTGTGATTGAAAAGAGAGCGAGAAAGAGGATTAAGTAAGAC
TAATTATATAATATCAAAAGCATAGCACCTGGCTTGTAGTTAATAATAATAGAAATTTAA
TGAGATTTTCCTAAAAACAATTTCTATTCTCATTTTAATTTTGACTTTTATTAAAGTAAT
ATACATATACAGTTTTTAAATAATTTCAAAGCTTCTATGGAGAGACAACCATCCCCAGCT
GTATCCTTTTTTTGTCTCACATCCATCACTCAGAGGAAAAACTCTATTTCTAGCTATTTC
TTCTGGTACTTAGCTTTTAATTCCTGGATAATATTCTTATATTTCTTAATTTATTAATTT
AGATATTGGCAACATTTTGTTAAATCAATCTCACCTCAACATTACTTTTGAGCTGGATGA
TTCACTTGGAGATTTCGCAAGACTTGGCAGAATGGTTGTATTCATGTGTATTAGTCTGTT
TTATGCTGCTATAACAAAATACTGCAGACTGGGTAGTTTACAATGAATAGAAATCTATTG
GTTTACAGCTCTGGAGTCTGGGAAGTCCAATGGAGTGGCCAGCATCTGGTGAGGGCCTTT
GTGCTGTGTCATTCCATAGCACAAGGAAGAAGGAGGGACTGAACCATGAGCAAGTGGGAG
CATAGGTCGAACTTTTATTTTTTTAAAAGAAACCCACTCTGGTCAGCTGACTGGAATGAA
TAAGCTGATGCTCTGTGAGGCACAGAAGTTAATAGCAGCTGGAGTTCTGATGGCAGTTGT
TGATAATGAAACGTAAAAATAAAAGTAAAAAAAAAAAATCCACTGCCATGATAATAGTGT
TAATTCATTCTTGAGGGAAGAACTCTAATAAGCCCTTAAAGATTCCAGTTCTCAATACTG
TTGCATGGGGGTTAAGTTTCCAAAACCTAAACTTAGGGGAGGGGTACATTCAAACCATAG
CATCATGGCTAAGATTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT
ATCTATCTATCTATCTAACTTTTCAGCAAAAGAAAGAGCAAAATCAGCAACAATAAAGGA
CACATGGGATGAAGTCCAGAGGAGACCAGGTATGCGCTACCCGAATCCTGTCCTCTCCAG
AAGAAGTCACATAGGATGCACTCAATTCCTTCACCTGGTATTGACAGCTGCAATATGTTG
TCAACCAGGAAACTCCTTGGAGATCAAGTGTCCAGTGTTTTTATTATTTATTGGGGGCTT
GTCACCTAGGCATCCTCTGCTTAACATGAGCAAAATTCTAGGCTTGTGAAAGAAAAGCAG
ATGTTCAGAATAAACCATATTGTTTGCACAAACGATTTAGATACAGTAAATTGCTCATCA
CTTATCCTGAAATCCAAGATGTTAGCCAAGGGCCAAAGGGCCAAGCTTGAGAACAAGATA
TCTAAAGCACAGCAGTCATATCTATTATACTTTTGTTTTTGCACAATGGTTTTTGTAAAG
ATTTTTTACACTAGAGTCAAGTAGTATGCTTATGATTACATCCAACAAATATGATTATAT
GTCCTTTCTTGTGCAAATTTTTTGTTTCCCCGAGTCAATAATTGCTTCTATTTGTTTATT
TTTATTTTTTGCTCACTTAATTTTCTAGGTCACTAATTATTAATTCTTCCTCCCCAAAGC
TGACAGAATTGTAAAAAGATAGTTAAGCAGTAAGATTTGAGCGGTAACTTGGGGGCATAT
TATAAAAATTCTTGTCTGCCATTTTCTGTGGATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved