Spermophilus_tridecemlineatus Locus Mono:165:SNORA71
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:165:SNORA71
Spermophilus_tridecemlineatus
Mono:165:SNORA71
GeneScaffold_5082
SNORA71
1001..1133
2133
TTAGAGTTAACTCTTATTTGTGAAGAAATGGTGTGCTTGCCAACATTTTTAGGATGCTT
AGTGTCTGGTAGCTACTGTGCCAAACCGTTTCCTGGTGCTTACCATGTCCTGCTGTGAGC
AATGACACCTGGGTGCCCATCAGTGCTCCTTGTCTCTTGCAGATGAGTCCACTGTGTACA
GAGGCATCATGGGAGTTGTCATTGTCAGGAACATTCTACACCCCAGGAATCTTGAGGTAA
GATTTCTGGTCCATTTTCTAGTCTCTCGTATTGGATACAGCCCTGTTCCCAGGGGCTCTG
GGTGATGATGTAGGGGAGCTGAGAGGTGAGGTAAAGGTGGTACCATGGGTCCCCAAATCT
ACCACCCACCCAACCAATTCTAGATCACACCTGACCCTTCACATACCTTCAGTGGCTGCT
GCAGGGGAAAGCCTCCAAGGTCCCACGTGTGGAATGAGAGGTCTCTGGGACATCTGCCCT
CTCTACCTGGGCACCAGCAACAGCATACTGTAATGATAAATGGGTGGCATGAGAATCCCT
TCTGCTGCTCTCTCAGGCACTCTACCACTGAGCTATACCTCCATCCCTTTTGTATTTTGA
GATAGAGACTTACTAAGTTGCTAAGGCTGGCCTTGAACTTAGGATCCTCCTTGCCCCAGC
CTTCCAAATTGCTAGGATTAAAGGCATGCTTCTCTGCATCAAACAGAACCTAATTTTTTT
ATTTGAAAAAAAGAAGTGGTGACAGAAATGACTTTTGTTGTACTTGAAACCCCATGATTC
TTACCATTACAACCCTAACATTTTTCCACTGTTTATGTCCAAAGTGACTTCTCTTTGATT
CTCCTGGGCAAGGAGTTTGTATGCGGTTTCTCTAGAAAAGAACGGTCATGGTTGGGTCCT
GTGCATGGCTGGCTGGGCTATTTTCATGAATTTTCCCTGTACTATGCCATAGGCTACTAC
CATCTGCTGCTCTTCCTTGACCTGTCTCTGCCTGTGTGTGTACCTGCATTCAAAAGTGAT
CACGGGCTGCCTGTGCTCTGATCATCCATAATGCAGGGAGAGGAATTGCTGAAAGCCATT
TCCCGTGTTTGGAGGGTCCAGTCTGTCCCTCTCAAATGCTGGTGCTTTCACACACTCTCG
CTTCTTTCCTGCCAACATATTCTGACCTCAGGGATGCTGGGGGCCGCTGAATGAGAATCA
GTGATGGGAGACATTATGGCTTAGCCTCCTGTTATCAGAGACCAAACTATATCTGCATCA
AGGTTTAGATACTTTAGATGTTCAAAGGAACCAGGATGAATGATGTATAATGAATAAGTG
TAATATTAAATGACACGTGTTTGTGGCCATAGAATTTTCAAAAGGAAGCAGTCTTTTGTA
AGCGTAAGGCTAGGCAGGCAGTGTGCTGGGCAGTAGGAACGTACCCCAGGGAGTAGGGAG
CAGCATGAGGAAGACTTAGAGGTTGAGTTGAGCGAAAGCTCCTGTCCCACCAAGGAGACA
GATGTACAGGCCAGTAGTGATAGCAGGGAGGGATAGACTTTTTGATTGTTCTCTAGTATT
GAGGTTCCTTTTTCATTTGGCGTGAAAAAAACCTGGTAGCTCATATCTAATGGATTGGGT
ACATTCTCATTGATGTCACCATGAAGAAAAATGGGATAACCATTTAGCCATTGGAAACCA
AACACTTGGGTTAGGGATAAGGATGTAGCTAGTGTAGAGCACTTGCCTAGTATATGTGAG
ATCCTGGGTTCCATCTCTATCACCACCAAAAGAAAACAAAAAAAAGAAAAAGAAAAAGCA
CTTCATTAACCTCCCCTTTCTGTGGCCCTCTCCTCACTCTAGGGATGCTTCCTTGGATCT
GGAGATTATGGAAAGAAGGCCCAAGGGATAGAGGCACTGACCCTTTCAGGATGGTGACAT
GGGGTGCCAGCTCTCTTTATGGTGATTTATTGCCAAGAAGCCAAGTCAACCTGTGTTTCT
GAGATTGAGATAGAAATTCCAAGCCGCTGGCCTGGACTAACTTTCTCTTGGTCTGTGGTG
TTGATTGTGGACACTGGCACAACAGAAAGTGAAGTGTGATGTTGCTACGTGACACATTGT
CAGACCTTGCCACTGTTGCCTCAGCACAACGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved