Spermophilus_tridecemlineatus Locus Mono:38:SNORD88
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:38:SNORD88
Spermophilus_tridecemlineatus
Mono:38:SNORD88
scaffold_153497
SNORD88
1001..1097
1579
TAACAAAAAAGAAAAAATCAAATATTTTTAAAATGGAAAACATCTTAGTGTGACACAGT
GGCACTCACCTTAATCCCAGCAGCATGGGAGGCTGATGCCAGAGGATCACAGTTTCAAGG
CCAGTCTCAGCAACTTAGGGAGATCCTGTCTCAAAATAAAATATAAAAAGGACTGGGGAA
TGTTGCTAAGTGGTTAAGCACCTCTGAGTTCAAGCCCCGGTACCACAAAAAAAAAAAAAA
AAAAAAAGAATCAAAATGGAGAAGGGATTCTATAGTCTTATATTTTGGGGATAACTGATT
CAAATCCATGATGTAATTGAGTAGGATATAAATTAATTTAAAATATCATTTATTCCGTAT
GAGATCCCATCCCAAGGATCTACCTGAATACATGTAAAATCTCTCATAGTTATAATGTAA
AGAGCACTTGACTAGCAAGATCACTTAAGGGTGAATTATGAATCTTAGGCTATTGAAGCC
ATCAGACCCAATTTCAAATATTGATTTACGGGGTTCTGACCACTCCTTGAGAATAAAGTG
CCCCCCCAGGACCTTTGACACCTGGGGGTCTGAGGGGTCCTGGCAAAAATATATACATAT
ATATTGGTTTTACCAAATTGTAGCAGAATAAATCTGGACAAATTATTAAAGCTATTTTAG
CCTTCAGTTTCCTCTGTACAAACATGTCAGGAGCCTACCTCATAAAAGAATTGTACTTCC
TGAGATGTGTTTTTAAAGAGCTTGACACAGTAGCAGACACCGTACAATTTATTAAGAACA
TGCACATACATGCTTGCCGTGATGCTCCATGCTTTATATATAGTGGTTATGCGAGCACTT
GGGAACCGCTGGGACCACGGGGACTAGAGCGAGCTGGCTCTCCCTGTTTTTATAAACAAG
ATCAGGCCTCAGCTACATACAATGATTTGAGAGATCTTGGGCTACACTGTCCCATAAGTC
TAGATGGTTTCTCTGGATCCAGCTGATGGTCATTTAGATGTCCCCCACTAGAGTTCAAAG
TTCATGTACTTCCCATATTGATCTTACCACCCATGCCCAAGGACTTGTGTCTGCTTAGTT
ATACAGTCCTTTCCAATCGTGGAATCCCTTCAGTCTGTATAGTACCGTGGAGAGTAAACT
CGACCAACTCTGGTTGCTAGTTTAAAAAGGGATATACTTCTCTTTAAATGGCATCTCAAT
TAGTAAAGAATATTGTGTTAGTTTGAGCACTGCTGACACCCTGTCTTGATCCTCAGGTTA
AGATTTAAACAAGTAAAAATCATGGCACATGTCTATGATATGCATTTCATGAGCAGAGAG
GAAGCGCCTACTGACCACACTCTGCTCTTCCCGTATTGGATTGAGATACAGCACCACACA
CCCTCCACATTCACGATGACTAGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved