Spermophilus_tridecemlineatus Locus Mono:182:SNORA9
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:182:SNORA9
Spermophilus_tridecemlineatus
Mono:182:SNORA9
GeneScaffold_3615
SNORA9
1001..1127
2127
AGCTTGCCTATCGGCACAAGGTCCTGGGTTCCATCTCCAGTGCTGGGGGGAAAAAAAAA
GTTGGACAATAAAGAAGTGTGGATGAGAATGTGGAGAAATTTTGGAACCTTCATACAGCT
GGTGGTTATGTAAAACTGTCCAGCCATTTTTGGAAAACAGTTTGGCAGTTCCTCAAAAAG
TTAAACATATTGTTACCATAAATGACCCAGCAATTATCTTCTTAGGTGTATACCCAAGAG
AAATGAAAGCATATGTCCATACAAAAACTTATACACAAAAGTCCTTAGTAACATTATTCA
TAATAGCCAAAAAGTGGAATCAATCCAAAGCCCATCTACTGATGAATGGATAAACAAAAT
ATGTATGCTCATAAACGGAATATTATTTGGACATATAAAGGAACGAAGTACTGATGAAAG
CAACATCATGGATGAACCTTGAAAAAATATGGCAAATTAAAGAAACCAGTTACAAAATGT
CATATCATATGATTCCATTTATAGGTAATGTCCTAAATGTACAAGTCTACAAAATGTAGA
GCTGAAGGCTTGGGAGGATATGGGGGAGTGACAGCTATGGCCATTTTCTTTCTTTTTTTA
ATTAATTTATTTTTTTGTGGTACTAGGCGTGCTTTACCACTGAGCCACACCCCCACTTTT
TTTATTTTTTATTTTGAGATGGGATCTTCCCAAGTTGTTGAGGCTAGTCTTGAACTTGCA
ATCCTCCTGCCTTAGCCTCCCAAATTGCTGGGATTATAGGCATTGGCCAGCATACTCACG
TGGCTATTTCCTTTTGGGGATTATAAAAGCACTGTAAGATTATTTTTTGTTTCATTTGCA
CAACCATGGACATACTATTAAAAATTATACTCTTGACTCTGGTGAATTTTATGGTGTATA
AATTATATTTAAAATCTGTTATAATAAAAAAACTACAAAACACATACTTGATAAAAAGAC
TTACATCCAAAATACATAAAGAACTGTTAAATTGACAATAAAAACAAACAACTCATTGTA
AAAATGGGCAAAGATGCATTCCTACAGTGCTTGCCAGAACCATTTTAAAATGGTTTGAGG
CCTTGCCCTGTCCTATCCAGAGCAAGGTAATAGAAATTTCAGAGAATTGAAAAAAAAAAA
GGGGGGGGTGGGAGGCAAAAGACCTAAATAGACATTTCTATCAAAGAAGATATAGAAATA
TCAAATAAGTACATGAAAAGATTCCTGATATCACATATTATTAAGGAATTGCAAATTAAA
ACAACTACACACCTATCACAATGGATAAACTCCAAAGAATTGACAATATCAAGTGCTAGC
AAGGACATAGAACTCTCACACATTGCCAGTAGAAATATAAAATGGTACAGCCACTTTGAA
AGACAGGTTGGCAGATTCTTACAAAGCTAAACATAGTCTCTTACCATATGATCCAACATT
GTGCTCCTGGGTATTTACCCAAAAGAATCCAACACTTATGTCCGCACAATAACCTGCACA
TGAATGTTTATTGTAGCTTTATTCGTAATTGCTAAAAACTGGAGGCAATAAAGATGTATT
TCAAAGGTGAAGGGGGTAAACAAACTGATAATCCATACTATGGAATACTATTCAGCTATA
AAAAGAAATGAGCTGTCAAGCCACAAAAAGACAAAGAAACTTTAAGTGTATATTGCTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCACAACTGAAAAAACATTT
AAAAAGGTTGGGGGCGCGTGTTGGATGCGGCTTAGTGGTAAAGCGCCCCTGGATTCAATC
TCTGGTTAAAAAAAAAAATCTATAGAAACTGTACAACATAGAGTGAACTCTAATGTAGAC
TGTGGGTTTTAGTTAATAATAATAATAATATGCCAATGTTCACCATTTTAAACAAATATA
CCATGCAAGATGTTAATGATAGGGGAACCTGGGGTCAGGGCACAGGCTCACTCACCATAC
TATCTCCTTGGTTTAAACTTTCCAAAAAAAAAAAAGTCTGTTAATTAAAAAACAAACTAA
GGGGCTGGGGTTGTGGCTCAGTGTTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved