Spermophilus_tridecemlineatus Locus Mono:69:SNORA44
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:69:SNORA44
Spermophilus_tridecemlineatus
Mono:69:SNORA44
scaffold_9724
SNORA44
1001..1129
2129
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNACTAAAAAAAAATTAAAGTGTATATGTGTCTAAAC
ATATTGCTTAATTTTCCTGTGCTTTTGAATGTCTTAATGGTATTGTACTATCTATGATTT
CATGGGCCCTGCATTTTTAACTTTATATTAGATAATCTATGATTTATATGATACTGAGTA
TAGCTATGGATCATTTGTTCTCAGTCCCTGTATAATATTTCATTGTATAAATATAATACA
ATTTATACAACCATTCTCCTGATACTGAATTCTAATTAATTTCCTTTCATGACTCCTATA
AACTGTTATGAGCCTCTCTCCTGGAAACATGTACAAGATTTTCTCTGGGATTGCTGAGTT
AGGGTGTCTCCATGTTCATATTTCCAGGAAAATATCAAGGTCTGTTTTCCAAAAATGATT
ATCTAATATACCTTTACAATACCCTAATTTAAAGAAATTCCCAGCATGTTTCCCTGGCAG
TCACTCTTTGTGGCCATGGACTCTCCAACTACATGCAAGAGCAACATGGGAAACACTGAC
AGCTTCAGTTAGCACAATACCTGCAGCTGCCACTCACCTTTCCCATGATATATCAGGAGG
GAAAAAAAAATCCTACTGTTCTATATTCTCTCCCAAACTTTGTGAATTACAGCAATAAAA
ATTTAAAAAAAATAGATTCAGGCTACATTTGGGAGATATAGCACACAAAGACAGTGGTTA
AGAAGGAAAAGTTAGAAATGATTCACTATTTACTTTTTAATATTCACTAATATAATAAGT
ATAATATTTCAGTTTGGTCATCATTTTAGTCAGATTTTTTTTCCTGCTCTGATTAAAAGA
TCCAACCAGTACAACTGTAGAGTAGAGGAGGAAAGCTTTATTTAGGGTCTGTTTCAGAGG
TCTCAGTCCGTAAGTGGCTGGCTCAAGGTGAGGCAGGAGATCATGATGGAAGAGTAGGAG
AAAGGGAAGCAGCTCACATGATGATCTAAAAACAGAGAGAGAGAGGCTCCACTCCCCAGA
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved