Spermophilus_tridecemlineatus Locus Mono:181:SNORD45
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:181:SNORD45
Spermophilus_tridecemlineatus
Mono:181:SNORD45
GeneScaffold_2682
SNORD45
1001..1079
2079
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTATGCTTCACCTCTTGGATACCTGAAT
CTCCTAAATTTTAATGATCAAGAAATTGCTACTCAGTTTTATTTTTGGTCATTTCGTGGC
ATACTCTGGTAACTACAGCTCAGTAGTAGGTATATGAAAAGGTGTAGATATATGGAAAAA
TTAATAACTACATTATTTGGGGATTGTCTGAAATACTCGGATTGAGCTTAACGGTGGTGA
AGGAGTTAATGGGATTGCATACTTCATTATTGGAATGGTTTATGAGAGTAGAGGGTGCTT
TGAAACCTGAGTTTGATTAAACGGGAGTGCAAATTATTTCCCACCCAGACATTAAGAAAA
AAATTGCGTGCTTTCTGCCACGTGTTAAGTTTTCCCCATTTGGTAAGCTTTTACTTAACT
GAGTGAAAGACAGGAACAATAAATGCAAGTGGTAATTTTTGGGTCAATGATGAGCTGGCA
TGTATTCTGAATCAAAAGTTGATCATTAATACTTTAGCTCTAGAATTACTCTGAGACCTG
AAAAATACCTGAATTTGACTGGTTGTTTAAAAAGTTACATTTACAACAGATACCTGAGAT
TTTTTTAATTGGAAAATTTTCAGTGAGAAAATTCAGGTGTAAATTGAATATATGCTAAGG
GGCAGAGTAAACATTGATGAGATTGCTGCTTTTTTATTTTTGAAAGGGCACACCACAGAA
GGATGTTATCATCAAGTCTGATGCACCTGTCACCCTTTTACTGGAGAAACATGCAGATTA
TATTGCATCCTATGGCTCAAAGAAAGATGACTATGTATGTATGAATTTTTATGTTCAAAA
GTCATAAAGAAGCCTGACATATCTAAGCAATATAGCAGTATTTATGTCTTGTTAAAGTGG
TATCCTCTGTGCAGAGGACTGAAGATTTGCCCTTAAAGTTTAATATGTGTTGCTTGTATA
TCTGAGTTTGGTGGTTTGGCAGACTCAACCATGATCTTACCCATAAGTAGAGACCTTGCC
AGACAAAGAAGATAAGAGTATAAGGGTAAAAATAGGCTTTGTTTTGTAATTGAGGTATAC
ATTCAAGGTCAATGATGTATTGGCATGTATTACCTGAATTACTGCTGATGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved