Spermophilus_tridecemlineatus Locus Mono:168:SNORD60
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:168:SNORD60
Spermophilus_tridecemlineatus
Mono:168:SNORD60
GeneScaffold_1613
SNORD60
1001..1082
2082
TTCTAAGACAATTTTTTTTTTAATTTGTACTTTTGCCAAGAGTAAAATTAAAGTTCAGA
ATGAGCCAATTTTTAGGCCATTTTCAGAGTCTGAGAGTCTTGTTCCCTTTGGTATGAGGA
GTTTACCAGCTCCCTCACACACCTCACATCTGAAATCCTGAGAGCATTGCTACAGAGCCC
TTTCATCATCTTGTGAAGAGGAACACATAATCTAATTCAGAATTCTGACATGATGGACAA
TTCTGTGAGAACAAAATTAGTTTTCCTGTCAAGTGCAAAGAAGAAGAAGAAATGATTACA
ACAAACAAACAAACTTTTTTCTAGGATGAAAAGTTAAGAAAATAACTTTTTTTTTTCTTT
GGTGTGTGTGTGTGGAGTGCTTGGGATGAACCCGGAGCCTTGAGCATCCTAAGCACCCAC
TCTACACAAGCTATACTCCTAGTCTTGAGAATAATGTTTAGACTGAATCCTAACCATGTA
GTAATTAAGAGTTCACAAGAATGCAATCAATTATTTCTTTCTTTGGAGGTTAATTGCTCA
TGTGTTATTAGTACAATTACCATAAGTCTTGTTAATAGCTACCTTTTGATACATAGCTTT
TTAGGCTTAAAGAATATTTCAAAGGACAGAGAATAAATTCCTCATGAATCAATTCATCTG
GATTCCTTTCCTATTTTCTTCTTCCTAAAATGTGTGGAATCAAATTTTGGACACTGGAAT
AATCACAAAATTTGATTTAAGGATTATTTGTGAATTTCAAACATCCTTTCTCTCTCCTTA
GCTCCAGCATGGCTAATTTAGAATACGTTACAACTTTGGAACTTTCCATTCTGATTCTTA
GCCTAATAATAGAAATTAATTGAGTCATGGGATTATAGTTTCTTAGTAAGGAAATTATTA
AGAATTTAATATCTTGTAATGAATAAGTTAAATTTTATTCCTAGGTAGCTTCAAATCTTT
AATGTCATTTACCTTAGAAAACACTTTTAAAAATCAAATTAAGCCTCTAATGAACTACTT
TAATTCCTGACATCATGTATGAAAACTGCATAGGCAGTCTGATTATTGTCAAGACAGAGG
CTTGATAAATAGCTATATTAATACCTATTTTCTGAGTACTTATTATTTACAGAACTCTAA
GAAGGATGTTATTACCAATAATATTTTCAGAATGATTTTAAATTTTAAGTTACATGAGAA
ATTCTCTTTTTAGTGTTTTCATATATCTAAATTTTTAAGGAGTTTAAAATATTTATGAGC
AAAGATTTCTCTCACAAATATATGATATTTATTTAACATGAAGAGTATAGTAATTATCTT
GAATTAATCATTTAACGATCTATGCAAATATCAAAACATCAACCTTGTATGCCATAAATA
TATGTCATTTTCAATTATAACTTGGAGAGGCTGGGAGAAAACATGGAGATTTTTCCTTTA
CACAAAGGAGATAAATAAAGAAGGAAAACTAAGTATATTTTTTAATGAGTTGTTAGTATT
AAATCACTGAATTTTAGAGCAGGTTAAAATCTTTAAAAAAAATCAAAATATTTATTTGAT
TTTACTATAGGTATACATATTACATGTCTACTTTAAACAAATGCAAAGATAATTGATCAT
CTTTTCATTTAATGTTAACAACATAAATGTGGCCAAGGATTCAAGGAGATATCTTTAATT
GACATTATATTGATTTACAACTTTTTCTCTAAGTATTTTTGCTTTAAAAATAGAAAATAT
ATTTTTAGAAGTTCTGAATTTTGAGATTTTTTTTGGACATATAAATTCTGATGACTGTAT
TTCTAAATAAACAACATGGGCTCTAATTCATTTTTTCTTAGTACTATTTTACAATGACAT
TTAACATATCCTGCCTTGTACATGTTGACTCTCCAGAAAGTGATGCTCTTGACATCAGGA
ATCATGATTTTTCATATTCTGTATACTATAGTTCCTAACTCAGTGTCTTCCACCAGGATA
AAGTTTTTAAAATATCTATTGGGGAAAAAATATACTAAGTGAAACATCTGAGATCTTGCT
AAGCTGATAAATAACATTTTTTGTGTTTTTTCATATGCACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved