Spermophilus_tridecemlineatus Locus Mono:124:SNORD58
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:124:SNORD58
Spermophilus_tridecemlineatus
Mono:124:SNORD58
GeneScaffold_2904
SNORD58
1001..1066
2066
GAACTACAAGCCTGACTTAGTTGACTGATATTTAAAACCCATAACTTTATTTCTGGACA
CCAAATATATATGAGAAATTTGAGACAGTCTCTAAGGGGACTGGCATTCGTTCCAGGCAT
TCTCAAATCATATCCCACACTCCCTTTCTGCCCTCCCAGTTCTCGGTTTTTATCCTGAAA
TCTCGCGAGAGGTCGAGTTTTCATGAATTCTCCCAGAAGCCACCGCTCTTCCTCTTCCTG
TAAGCGGCCTGAGGTGAGTGCTTCTTTAGAGTCTGGGTACGAGTGTTCAATCCTCTGGTC
ATCACCGCCATCCTGGCCTCTGGAGTGCGGGCGTCAAGGACCGCGGGAGGAAAACTCTCA
GGGCTACGATTTCTTGCTGGAAGCGATGTTTCTCTGTGCAAGGAGACGTGGCAGAGTGCC
CGACTTGATGCTCCCGGGCCGGCAGGCCTCTGTGAACTGCAGAGGAACGTGATGGATGGG
GACGGGGGAGGGAGAAGCTCGTCGGCTGGTGGGGATACGGGCAGCTGCCCTCCGTGTCTA
CTCCGACTGTGGAGGTCCATGTCCCGCGGTGAGTGGTGGCCAGTACGCGGAGCATTTGTG
GCCGCAATGCGAGAAAGTTTTGAGGGAATAAAGGCAGATTGAAACCAAACCCTTCTCAGT
TAAGTGCTGCGAATTGCATGACTCCTACCTAACGTGGTTGATAGTGTAAAGTCTGTAGTG
TGGGAAGCTATTCCTGTGAAGCTGTGTGAGTGAAGGGGTTTCTGTAAAGAGGGAGGGAGG
GCGGAAAGGATCGGAGTTGGTTTTTGCTATGTCAGATGCCATGCATTGGCGGCATCATAG
GTCTAAAAGACCCACGTTTAGATCAAAACTGGCTGTTTTCTTCTAAAGGGGAAGGGAGAG
GGTTGATTGGAGGTCCAAATCACTATTCGTGTAATCAGCGCCATAGTGGCTGGTTGATGC
AGAGGGAAGAGAAGAAAGGACAGGGTGGAGGGAAAGGACGGCTGCGATGATGGCAAATCT
TAGGACACCTTTGGATTAATCATGAAAACAACTATTCTCTGAGCAGCTTCTAATATCACT
TAACACTTTGTTATTTAAAGTTCACCAGTTACCCTTAAGTATCTATTACTGACAAGTATG
GGGTGCTCCCTTCCAGGTGACCTATGAAAATGGTCCGGTACTCTCTTGACCCGGAAAACC
CCACAAAATGTAAGTGAATAGGACATAGATCTATAATTCTACTTGGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved