Spermophilus_tridecemlineatus Locus Mono:31:SNORD113
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:31:SNORD113
Spermophilus_tridecemlineatus
Mono:31:SNORD113
scaffold_105100
SNORD113
1001..1074
2074
AATCAATTAAATAATTCAGAAATGAATGAAGAAATTGTGGGCCTTCCCCAGGCCAACAA
GACATGCTAGTGTGAGTCAAAGATTAAAAATGTATGGATGACACCCTGAGGCCCAACATA
AAGACAGTCTTGTCTTTGTTTTCACACACTGTCTTTCTACCATTATTATTGATCAATGAA
AGAATCAGTGAACAAATAGATAAATAAGTCGACATAAAATAGATAGAGCATTGCTGAAGT
ACAGAAATGTCTGAGGAGGCCAGAAAGACGATTAACGTACATTGGAAACATGAAAGGCCA
TGAGAAATGAATGGCACTCGAGTGGCAGCTCTTTGGCTGATGATGACCCAGTGTGAATCA
CAGGCAGGGTTTGTGTTCTGGGTCAGTGGCAAGGTTGAGGTGGTTCATTTTCTTGAGAGA
AAGGGAATGATAAACTCAGAATTACTGATCACAGCTCTGATGTACACATCGGAAGGAACT
CTCTCGGGATGGTTCATGCATCCCTCGTGGGTTTGGAGACTGATGTGAGTCACGGTGCCC
TTGTGTTGGTTTAAGGATGTTCGCTGTAGCATTAAAGCTGTGCCATATGGAGAGGGCCAG
CTAGGGTCCAATGACAAGCACAGGGTGCACACAGAGTGCTCTATTTATCAATTCATTTAT
GAAAAGTGAGGATTTTTAGTAAAGGAGATACTTTTTTAAAAAAAAAATATTTTTTTTTAG
TTGTAGATGGACAAACTATCTTTCTTTGTTTAATTATTTTTATGTGGTTCTGAGGATCGA
ACCCAGGGCCTCACACCTGCAAGGCAAGCACTCTACCACTGAACTCTAGCCCCAGCCCAG
TAAAGGAGATATTGATCAGAGAATGATTTCATATGCAAGTTAGGGATATTAGGACTCTTC
AGGGGTTTTGTGGATCATAGTGCTTTAAAATTATTATTAGTGAATTTCTGAATTAATCAA
CAAATCATCTAGAAATCAGTCAGGATCAAATGGCTCCTGCCTGGACCAATGATGATGACT
GGTGGTGTGTGAGTCCAGCATGACGACTACATGTGTCTGAAACTCTGAGGTCCAACGCCA
AGGACTCTTGTCCATTTACCCATTCAGTGGGGTCCCCTAGGGAGATGCTGGGCACGAAGT
CATGGGCTTGGTTTCTGTGCTTAACCCAGAATGAATTATAAGGTACTCTTCTGTGCCAAT
GGCAATTTCCAAGTTGTTGGCTTTCTTAAAGAGAAAATGAAATGCCAACCTTTTAAGGAA
TGATTTTGCACGTGTGACTGGCTAGATGATAGACTCTGCACAGAGCAGGGGTCTGGGGAG
GATGCCCCGGTCTGGATTCCCCTCCTCTGTTTTCTCCTTTCCAGGATGGACGTGCTCCAG
TTGACTTTAGCATGCTCTCTGGGGCAGGAGCTCTGCAGCTTTCTTGGTCTGTGGGGCACA
TGTTGACCAAGGTGAGTCAACAGTCTGTTCCTCCATGTGACCCATCCTAACAAGTGTTGC
CAGGAACATCCCAGGATCTTGTATCAGGCTGTTGTGTTGATGAATTCATCATGATGGTAT
TATAAGCAATCGATGGTATCAGGGGCCACATAAGTGAACACATGATGCATAAAGGTGGTA
ACCATGTTCATTGTTAAACTATATAATAAGTAAAATAATATTGATCATAAAGTGGAATGA
ATGATAATGGAACAAATGTACTTCCTCCTCCTGTGTATATTGTCTCTGACTAAATATAGT
AATGGAAAGGGAACACATAATACTGTTTGACCTAGTGTTTGATTTGTTAAGAGAAAAATA
AATTATCACAAATAACCTGGGAGCCTAGGTAATCAGAGGGAGGCCTGGGGATCAGTTGAC
AGAGCGTCTCAGTGTTTTCAGTCATCTGCTCTGCTCTGTGCTCCTTGGAGTGGATGTACC
TGTGCTGATTCGAGGGTGATCCCGACGGTGGTGAGCTCTTGCCTCAGCAGGCTCCGAACA
GAGGCATCAGCGTGGGTCGTATTTGGTGGTTGTCTTGGTTTATGTCAATGATTAATATTT
CACATGTTAATGTGAAATCTTACTTTAGTGGATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved