Spermophilus_tridecemlineatus Locus Mono:167:SNORA51
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:167:SNORA51
Spermophilus_tridecemlineatus
Mono:167:SNORA51
GeneScaffold_3241
SNORA51
1001..1124
2124
TTGATTACTTAGATTTACAGTCTTAAAACCAGATAGTATGAATCTTCTCATTTTTTTCA
AAGTTGTTTTGGTAATTTCTTTTTTCACATAAATTTTAGAATCAGCATACTTAGTCTATT
GGAATCTTAATTGGGATCACATTTAACCTATTAATCAATTTAGAGAAGAAATGACAACAA
TGTTGAGTCTTCTAATCCATGAACATAGCATATCTCTATTTTTATCTTCTTTGACTTATC
TCATCAGACTTTTATAGTTAAGCATATAGATTTTGTAGTTTGTCAGATTTATACCTAAAT
AATTAATGCTTTTGGGTGTTCTTTGGAATACAATTTTTTAAATATTTTAATATAAAAATA
TTCATTTTTTTCATTGTGAATATATAAAAAGAATTTTTCATGAATTTTGTATATTGATCT
TATATCTTGAAATCTTCCTAAAAGTCACTTATTAGCTCTAGCAGTGTTTTTAGACTCTTT
GGGATTTTTCTGTGTACCCAATCATGTCTTTTAAAAATAGAAATAGTTTTATTTCTTCCT
TTAAAATCTGTATGTCTTTTAATTTACTTTTCATGCCTTATTACACAGGTTAGGACTTCC
AATATGATGTTGAACAGAAATGACGAAAGTGAACATGGACATCCTTGCCTTGTTCTATTA
TCCAAATCATATTCCTATTTCCAAGTTTAGGGTGATAAATACAAAAACGTTAAACACATT
TGAATCTTGCTCTAATTTTTTTTTTAAATTTGTAAAGCGGCTTATTTGGCTCACTGTTCT
TAATAATATTAATAATAATTTATAACTAAAGCAAATAACTTACTAAACATGATATCAAAA
TATGTTTTGGGGAGTACTGGGAAGTGATATTAGTCAAATTATTGTTATATTGTATTGTAT
CCAGATACCATCAGTATGTACAACTATAATGCACCAATAAAAATGTGAGAAAAAATACAT
TCAAGAAAATTAGATGTAACTTCTCTTAAAAATAGAGAATCAGCTCCCTAGTGCTTACAA
TAGGCTGCGTTCTACCACTGACTAAAAGGGAACAGACAAACATGCCCTGAATACAACTCA
GTCTAGGCCCTGTTTCTGGTCTGTATTGTAAATGGGGAGCCATGGGGAAAAATTAGCAAA
TCATAGCACTTTTAACAAGAGAAAGTAGTTTAAAATAGAGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAATTACTTGGGTTGT
TATCTTGCTGCAAATTGGCAGGTTTCATGGCAGTTTGAACCTCCTTTTGTGTTTCCTAAC
ACATGCTTTTTTGGTACTGGGGATTGAACTCAGGGGTACTCTACATCCCCAGTCCTTTTT
ATTTTTTAATTTGAGACACAGTCTTGCTAAGTTGCTGAGACTGTCCTTGAACTCATGATT
CTCTTGCCTCAGTCTCCTGAGTTGCTGAAATTACAGGCATGTGCTACCATGCCTGGCTAA
CACATACTATTTTGAATTTCAGTCACTGTGTACGTGTCATCTCCCACACCAAATAATAAA
GTTCTTCAAGGATCAAACAAAACTTTCAGATTTTTTTAATCCAACAGCTTCTCCTACAGC
ATTTTGTAAAGGATGTTGTAGCATTATGTAGATGCTCAATAAATGTTTGTAACTTTTATT
ATGGTTAGCTTAATTTTTCAAAAATAAGTAGAACAGTCCCACAGTAGAATATAAACTTGC
ATTTGAAAGTACTAGGTATGTTTCATAATATGTGGAAAAAATGCTGTAGTTGAGACATAA
AGAAAGATCAATAATTTAAAATAGTAATTGGACTATCAATCAAAAAGTTAGAATGTTCTT
GTTACCAGCTGAGGTTAAGTTTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved