Spermophilus_tridecemlineatus Locus Mono:23:SNORA31
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:23:SNORA31
Spermophilus_tridecemlineatus
Mono:23:SNORA31
scaffold_10242
SNORA31
1001..1125
1773
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATATTTTTAGTTCCTTGATACC
TATTGCCCTAATGCCATCCCAGAGGGTTGAGAGTTGTAATAGTTCATTATAGGATTTAAT
AATATATGACTAAACTTCTATTGAACTTTTTGTTTTTAGGTTAAAATTTATATTATTGCA
TTTAATTTAATGATGGAACTAAGGTATTTTTTCACACTGTTGGGAGAATTAAACCCCAGA
ACCTTTTGTACATGCACTCTTTCACCGAGCTACATCCCCAGCCCATTTATCTAATTTTTC
CCCCTCATTTCTCTAATTTTTAAATTAGCTGTATTGACTCATTTGGGAATTATCTTTTCC
CTTAGGCTTTACCTATTTAAAAAAAATTTAGTGGAGCTGGGCATGGTGGTGCGTGCCTGT
AATCCCAGAGGTTTTGGAGACTGAGGCAGGAGAATCAAAAGTTGGAAGCCAGTTTGGGCA
ACTAAGTGAGACTCTGTCTAAAAATGAAAAGGTCTGGTGGTCAGCATCCACTGATAGACC
TTGAACAATTTGCTGTGTTCTTTTGGTTTGCACTAGGATGCAAAAGAAAATAATCCCTGT
GCTTTCTGTCTTTGTAACAGTCCAGATTGAATTGGGGAACACATCTGTAGAAAAAGAAAG
AAAGCAAAAAAGTCTGGTGGCGGCTCAGGGGTAAAGTACCCCTGGGTTTAATCCCCAGTA
CTGGGAAGAGGGGCAAGTAGAGACACTACCGGCTGTTTTAACTGTTCTCTTCACATTTAA
GAGATTTATTTACCCTTCTGCTCATTAGCCCTTGATTTTTAGTAGTCTTCAGGATTTTGT
TTTATGTAGATCTCATGATCAAGACTTTGTTAATCCTGTTGTATTCTTTAGAAATTTTGT
TTTGCCTGTTAAATTTATTAAATATGGAAAAGTTGCTAGCCATTAGTAAAAGAAGAAATA
AGGCCATTTTAGGTAAAAATCAGATAATGGTAGTTCCAGTCCAAATTAATATGAGAACTA
TTTTAAGTTAATTTAGTTTGTGGTTGGATTATATGCTTTAAAAATTCATGACTGATTCTC
TCAAGCATTTTATTTTAAAAGCACTTTTGAAATATTTACAATTTTGCATTGCTGTGTTAC
AAAAATAGTGAACCCTTTTGAAAATTATTTTTATGATCTTGAAGATCACATTTTATGTTT
TGAGCATATTTGTTACTCCTAGGAATTAGTAAAATTTAGCCCAGGGCATTTAACCACTGA
GCCACATCCCCAGCCCCTTTTTATTTTTAATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved