Spermophilus_tridecemlineatus Locus Poly:2:SNORD88
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:2:SNORD88
Spermophilus_tridecemlineatus
Poly:2:SNORD88
scaffold_753
SNORD88, SNORD88
1001..1092, 1369..1459
2459
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCATCTGAATAAGGGGGTAACACCAGGACCCCTGTGATGTCTAG
CACTGGGCTCTGACCATTCTTTGAGGATAAGGTGCCCCCCAGGACCTTTGACACCTGGGG
GTCTGAGGGGTCCTGGCTCCTGGTAGGGGATGGATTGGGATAACAATGATTTACCTGTAC
CTCATGGACCTTTTTTCCCTCCCCTTCTCCTTTCTGTCTACAGGTGGCTTCTCCAGGTGT
CCTGCTGCCCAGCTTTCCCTCCTGGTAAGGGCAGAGGAGCTGCCTGTTGGTAGGGAGTGC
AGCTCAGCATCCTGTACTTTGAAGCAGTGGCTTCCTTAATCTCCATAGTAACCCTGTGCT
GGGAGGGCTGTGCTGGGCCTGGGTTGCTATCCTATCAGGGTTGAGCTTGGGGACCCCATG
ATATTCAGCACTGTGCTCTAACTGCCCCTGAAGATACAGTGCCATCCAGGACCTTAGACA
CCTAGGGATCTGAGGGCCCCCACTCCAGGGAGGTGCTGGGTGGGGTGTGGCTTTTTCTAC
TTCCAGCTTTTGCAGCAGTGCCCTTCCTGACCCTCTTGCTCTTCCCTGCCTTGGGGCAGC
TGTGGCCATGGCTGAGAGAGTGCTGGCACCCACCCAGATGGGCCGGGGAGACCGCTACTA
TACATATACTGAGCTCCTGGCCATTTCTCGGCGCTTCAAGCAGAACCCCAACGAGCTTAT
GATCACCTGGATCCTGCGGGTGTATGACCAGGGGGGCCCAGCTCTGTCCTTGAATTCTGG
GGAGCTGGCACTGCTGGGTGACCTAACCCATGATGCCATCTTCAACTACCACTGCAAGAC
GCTGCGGGGTGGCTGTAAGACACTGCTCACCTGGCTACTACAGGCCTGGCGCCAGCGCTG
GGAATCCTTCCTGCACTTTGAGGCCACTGAACTGCCTTTCCGTCCCTGGACCACTATGGA
GGAGGGCATCCAGCTGGTGCGTGAGCTGGGCATGCTCGACTGGATCTACCGCGAGCTGCC
TTCGCCACTCTCACCTCCTGAGCCCGAGTATGCAGCGCCAGAGGACGTGCCTTTCACTCA
GGGCCTGCAGAGACGCCTGCTTACAGCTGCGCCCTCAGAACTGCGGCTCTCACTGGTCAG
CCTGCTGGTCAAGGGCATGACCGTGCTGGAGGCCGTGATGGAGATCCAGACAATTGCTGA
TGTGGGTTTGCTGTGGCGCCAGAGCCAGCCAGGCCGTGCCAAGCTCATGCTGGGGCCTAA
CCCCACACGCAAGGACCTCACAGGCTGGCTACTCAGCCATGGGGTGCCCAGGGAGAGAGT
GGATAAGCAGCCCACCAAGGTCCTCCTGGAGCTGTACATCAAAGAGGCCAAGCGCAGCCG
CAGCCAGCCAGTCTATGGGCTAGGAGAGGAGCAGCCGCCTCCACCTCCCTACTCTGACCA
GGCCTGTGGGGAGGAGCCGCCCATACTCCATGACTAGCCCCTTCCAGTGGGTGGGGTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved