Spermophilus_tridecemlineatus Locus Poly:8:SNORD116
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:8:SNORD116
Spermophilus_tridecemlineatus
Poly:8:SNORD116
GeneScaffold_2908
SNORD116, SNORD116
1001..1092, 5637..5728
6728
NNNNNNNNNNNNNNNCTCAGAGGAAAGAGCCCTTAGTGTGCTGTGGGGCTTTACGGTGA
CCCGTGAGCTCGCAGGCATGGGGGTAGATGAGCCTCTTTAGAGAGCCCACACGCGCTTTG
GACACGAAATGGCCCACCGTGTGTCAGACTCAGGGATTGACTCTTCTTTTAGAAGGCGCA
TGTGACCCGAGACTTCATGTTTTCATTTTTGATCGTAGGACAACCAGAGATGGTTTGGTA
GTGGAAAGGCCTAACTGGGTCCAAAGTCATTCGTAAGGATTGTGCCTGTGCCTGAAGGAA
GTAGAGAGTGATGAAATTCACCTCTTTGCCAAGTGCTTTTATAGGCGCTGGACAGGCGTT
GAGGGTCTCCTCTCCTGCACAAGTTGTGGGGTTCAGGCATTGGAACGTATGGGTGGGGCT
GGAGCTCCTGTTGGAATCCATGTCACGTGGGGCTCCCAGATGGCCCGTGGCGATGGCCCA
GAAAGGCAGGAGCTTTGCAGAGGACGTACTTTCTCAGGTTCGTCCTTTCTTTGCTTGGAC
ATCCTGTGGAGGGAAGGAGTCAGGGTGAGATTGGTTTGTAGAGTTGGATGGAGATTCTCA
GATGGCTTTCCTGTTGTGGGAAGAGTTTGTTGGGCAGCTTAAGAGCCACATGGGAACTGA
GCTCAGGCCGGCATGGCGTGGGCAACTGAAAAGGCTGCCGTCCCTAAAGAGTGTGAACTG
AGGAGCAGCAGGCTGCGGAGCAGGCCAGTCATGGTGATTTTTCACGGGCCTCCCTCTCTT
TTGTCTCCTTGCATACGCACGGCAGGTCGTGTTTCCACGGAAGGATTGAAAGGTTGCCGC
CGGCTCCTCTGGCTGTGGGAAGATGCCCAGGGAGGACGGGGAGCGCCCGCCTGCGCGTGC
CCTCTGTTTCCTGAGTGTGGCCCTTCGTAGCTGACGATGGTAAGCGTCCCCTCGCCCCAG
GTCACCGAGGTTGCTCCTTGCCAGGTGAGGGTCACAAGCGTGGATCGATGATGACTCCCA
CAAAAACATTCCTTGGAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCTCTCTCATC
GAAACTGAGGTCCACCACGTAGACGTAGGGGGCTGCAGTGAGCTGGGTGGTGGAGGGGAG
AACCCTGTGGCCCTTTTTCGACGGGGGCCGTGTCGGAATGGACCCTGGAAGGGAAGGCCC
CTTTCTGCCGAGTTCACCTGGCGTTAGGACCCCGAGCCCGTGGTCCTCTGAGTGTCAGTC
CTCCTTTGGTTTCGGCATGCATGGGTGATCCAGAGCTCAAGGCCTGGGGGAAGACGTTGG
CCTGCCCGGGAAGATTTCCTAGTGGGTGTTCGGCGGTAGGGTTCAGCCGTACTAGGGGGT
TCTGGGCCGTGGCACAGGAGGATAACTCTCCTCCTCTTGTGCACTGGAGACGTTTTTGCC
AAGGCGAGTCGCGCCGTGCTGGTCTGCTGGGTGTCCCAGAGAAAACTGAGGTCCACTTTC
ATCGGGGGCCGGAGCCAGGCCCAGCGCAAAGCAGGGGAGACCCTTCTTTAGTGCACAGGG
GCGTGGTGTTTCCGGGAGTCTGATGGGTTTTCTCTTTTCCTGGAGATGCTTCAGTGTTGC
CAGTGGTATTGCCACACAATGTTGGCAGGAGCCATGGTCCACCAGGGGAAGGAAGGGTGG
GTCTCCAGAGGGACCAGTGCCTGGATGAGAGTAGATGGACATAGAGGGAATGCAAATGGA
GGAACTGGGTCTTCCCACAAGCGGGTACTTTTGCTGCCACTTGTGTTAATGGATCCCCCT
GATAGATGGTTGGCTCTCGAGTTGGGGCATCAGAAGTGCTTCAGGAAAGAGCCTTAGTAT
CGTTGTGTGCTTTCGGTGCGCCCGTGAGGCCGCATTCATGGTGGTCGATGTGCGTCCTGA
GAGAGCCCATACGCGCTTTGGATCCCGAATGAGCCACCGTGGTGGCAGACCTCAGGGATG
ACTTCTCTTGTAGGAGGCGCATGTGAACCCGAGACGTCAGCGTCTCGTTTTTGAGCGTAG
GACAGCCGTGAATGGTTTGGGTAGTGGAAAGGCCTAACTGGGTCCAAAGTCATTCGTAAG
GATTGTTGCCTGTGCCTGAAGGAAGTAGAGAGTGATGAATTTCACCTCTTTGCCAAGTGC
CTTTCATAGGCGCTGGACAGGCGTTGAGGGTCTCCTCTCCTGCACAAGTTGTGGGGTTCA
GGCATTGGAACGTATGGGTGGGGCTGGAGCTCCTGATGGAATCCATGTCACGTGGGGCTC
CCAGATGCCCGTGGCGATGGCCCAGAAAGGCAGGAGCTTTGCAGAGGACGTACTTTCTCA
GGTTCGTCCTTTCTTGCTTGGACATCCTGTGGAGGGAAGGAGTCAGGGTGAGATTGGTTT
GTAGAGTTGGATGGAGATTCTCAGATGGCTTTCCTGTTGTGGGAAGAGTTTGTTGGGCAG
CTTAAGAGCCACATGGGAACTGAGCTCAGGCCGGCATGTCGTGGGCAACTGAAAAGGCTG
CCGTCCCTAAAGAGTGTGAACTGAGGAGCAGCAGGCTGTCTAGCAGGCGGCTGCGGAGCA
TGCCAGTCATGGTGATTTTTCATGGGCATCCCTCTCTTTTGTCTCCTTGCCTATGCACGG
CAGGTCGTGTTTCCACGGAAGGATTGAAAGGCTGCCACCCGTTCTCCTGGCTGTGGAAAG
ATGCCCAAGGAGGACAGGGATCACCTGCCTCCCCCTGCCTTCTCTTTCCTGAGTGTAGTG
TTTCTTCTCTTTTGAGGATAATGATTGTCTTTTTGTTTGGCAGAATCTTCCTCATCCAGG
GTCAAATGAAACTTGCGTATTAGATTATGAATCTTTGATGCCATATCATGATTGAAAGAT
CTCATGCACCAACAGGAATGCATACAGGACCTCTCGGTGTAAGAACAACAGCATATCCTT
TTCCCCATGTGATCAGAGGTAAAGGGTTCCACCATCCTGGGTCTGGTGGAACCTTGTATT
TTACATGGGTTTTGGCAATGGGTGTTTGGGAATAAAATGTCTATCCAAGTCAGATGACCA
ATTGTGAGTCTTCTCTTCGTAATTTATGTTGAGTGCGTTAAGTGTAAGTAAAGTAATATT
TAAGGCATTTTTAACATGTGAGAGGGCTAGGTCCTCTTCTTTGTTTTTATTTTATGAGGC
ATGTCTTAAAGGTACGATGTGTTTGTTCAACAAAGTCTGGTCTGGTAGTATTATGAGGAA
TTCCATGCATTAAAATTATATTTCATTAAGTAGAACATCATGCAAAAACATGGGATGTAT
ATTCAGATGCATGTACATTTTTAAACCAGCAGGCTTGCCCCTAATGGCAAAGTAAAGTAA
TAAATGAGAAGTTCAAGCAGATACCTTTTCAGAACTATGGGCACTAGCCTAAATACACCC
AGAATTATTACCAATGGAAACAAGAGAATGGAGTGAAGATAGAAGGAGGAAAATGAGTAA
CATTCACTTGCCAAAGTGCATTATTAGAATGTAGACCACATGTGTTTACAAATTCACACA
TAGGGGCCTGGAAAGATGTACATTGAGAATAGTTATTGGCAGTGGCATGAGCCTGTTGAG
AATAAATGGAAAACATTTTTATTAGTGAGTGAGTATTTTGATGAAAAAATCCATGAGCTC
CCCACCGTCTGAAAATAAAGGATAAAGGGATCTCACATTGCATCTGCATGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGATGATGACTCCCACAAAAACATTCCTT
GGAAGCTGAACAAAATGAGTGAAACCTCTATACCGTCTCTCTCATCGAAACTGAGGTCCA
CCACGTAGACGTAAGGAGGCCTGCAGTGACCTGGGTGGTGGAGGAGAAGATCCCTGTGGC
CCTTTTTCGACCGGGGCCCGTGTCAGAAATGAGACCCTGGAAAGGAAAAGGCCCCTTTCT
GCCGAGTTCACCCTGGCGTTAGGACCCCGAGCCCGTGGTCCTCTGAGTGTCAGTCCTCTT
TTGGTTTCGGCATGCATGGGTGATCCAGAGCTCAAGGCCTGGGGGAAGAAGTTGGCCTGC
CCGGGAAGATTTCCTAGTCGGTGTTCGGCGGTAGGGTTCAGCCGTACTAGGGGGTTCTGG
GCCGTGGCACAGGAGGATAACTCTCCTCCTCTTGTGCACTGGAGACGTTTTTGCCAAGGC
GAGTCGCGCCGTGCTGGTCTGCTGGGTGTCCCAGAGAAAACTGAGGTCCACGTTCATCGG
GGGCCGGAGGCAGGCCCAGCGCAAAGCAGGGGAGACCCTTCTTTAGTGCACAGGGGCGTG
GTGTTTCCGGGAGTCTGATGGGTTTTCTCTTTTCCTGGAGATGCTTCAGTGTTGCCAGTG
GTATTGCCACACAATGTTGGCAGGAGCCATGGTCCACCAGGGGAAGGAAGGGTGGGTCTC
CAGAGGGACCAGTGCCTGGATGAGTAGATGGACATAGAGGGAATGCAAATGGAGGAACTG
GGTCTTTCCACAAGCGGGTACTTTTGCTGCCACTTGTGTTAATGGATCCCCCTGATAGAT
GGTTGGCTCTCGAGTTGGGGCATCAGAAGTGCTTCAGGAAAGAGCCTTAGTATCGTTGTG
TGCTTTCGGTGCGCCCGTGAGGCCGCATGCATGGTGGTCGATGTGCGTCCTGAGAGAGCC
CATACGCGCTTTGGATCCCCAATGAGCCACCGTGGTGGCAGACCTCAGGGATGACTTCTC
TTGTAGGAGGCGCATGTGAACCCGAGACGTCAGCGTCTCGTTTTTGAGCGTAGGACAGCC
GTGAATGGTTTGGGTAGTGGAAAGGCCTAACTGGGTCCAAAGTCATTCGTAAGGATTGTT
GCCTGTGCCTGAAGGAAGTAGAGAGTGATGAAATTCACCTCTTTGCCAAGTGCCTTTCAT
AGGCGCTGGACAGGCGTTGAGGGTCTCCTCTCCTGCACAAGTTGTGGGGTTCAGGCATTG
GAACGTATGGGTGGGGCTGGAGCTCCTGTTGGAATCCATGTCACGTGGGGCTCCCAGATG
CCCGTGGCGATGGCCCAGAAAGGCAGGAGCTTTGCAGAGGACGTACTTTCTCAGGTTCGT
CCTTTCTTGCTTGGACATCCTGTGGAGGGAAGGAGTCAGGGTGAGATTGGTTTGTAGAGT
TGGATGGAGATTCTCAGATGGCTTTCCCGTTGTGGGAAGAGTTTGTTGGGCAGCTTAAGA
GCCACATGGGAACTGAGCTCAGGCCGGCATGGCGTGGGCAACTGAAAAGGCTGCCGTCCC
TAAAGAGTGTGAACTGAGGAGCAGCAGGCTGCGGAGCAGGCCAGTCATGGTGATTTTTCA
CGGGCCTCCCTCTCTTTTGTCTCCTTGCATACGCACGGCAGGTCGTGTTACCACGGAAGG
ATTGAAAGGTTGCCGCCGGCTCCTCTGGCTGTGGGAAGATGCCCAGGGAGGACGGGGAGC
GCCCGCCTGCGCGTGCCCTCTGTTTCCTGAGTGTGGCCCTTCGTAGCTGACGATGGTAAG
CGTCCCCTCGCCCCAGGTCACCGAGGTTGCTCCTTGCCAGGTGAGGGTCACAAGCGTGGA
TCGATGATGACTCCCACAAAAACATTCCTTGGAAGCTGAACAAAATGAGTGAAAACTCTA
TACCGTCTCTCTCATCGAAACTGAGGTCCACCACGTAGACGTAGGGGGCTGCAGTGACCT
GGGTGGTGGAGGGGAGAACCCTGTGGCCCTTTTTCGACGGGGGCCGTGTCGGAATGGACC
CTGGAAGGGAAGGCCCCTTTCTGCCGAGTTCACCTGGCGTTAGGACCCCGAGCCCGTGGT
CCTCTGAGTGTCAGTCCTCCTTTGGTTTCGGCATGCATGGGTGATCCAGAGCTCAAGGCC
TGGGGGAAGACGTTGGCCTGCCCGGGAAGATTTCCTAGTGGGTGTTCGGCGGTAGGGTTC
AGCCGTACTAGGGGGTTCTGGGCCGTGGCACAGGAGGATAACTCTCCTCCTCTTGTGCAC
TGGAGACGTTTTTGCCAAGGCGAGTCGCGCCGTGCTGGTCTGCTGGGTGTCCCAGAGAAA
ACTGAGGTCCACGTTCATCGGGGGCCGGAGGCAGGCCCAGCGCAGAGCAGGGGAGACCCT
TCTTTAGTGCACAGGGGCGTGGTGTTTCCGGGAGTCTGATGGGTTTTCTCTTTTCCTGGA
GATGCTTCAGTGTTGCCAGTGGTATTGCCACACGATGTTGGCAGGAGCCATGGTCCACCA
GGGGAAGGAAGGGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCT
GTTCCAGGCAGTAAGGTACTCCCTTTCCCCATCAGCATGTCTAGAAGAGTCCCTGTTTCA
GGTGCCAGCTATGAAGAAATAGCTTCAAAAGTAGACAGAGGCAAGGGCAAAATGAGTGCT
CACCCAAGCTGCTGACTTTATTTATACCAATAGGCATCATTAGTACATTATTGTTTATTA
TTAAGTGATCTTTCACTTCTTGTTCTCTGATTTTGTTTCCCCTAGGTGGAAAAATAGTCA
GTGAAAATATGTATTTGTTGTCTGTGCCCAACTGATTTTATTTTAGTTTCTTCTTGAGAT
GTTAAATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved