Spermophilus_tridecemlineatus Locus Mono:53:SNORA76
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:53:SNORA76
Spermophilus_tridecemlineatus
Mono:53:SNORA76
scaffold_145228
SNORA76
1001..1113
2113
TGCTAAATCCCACGTTCTGTGCTGTAGGATATCGTTGGCATATTGTCTAATTCAGCTAA
GAATTTGGACAAAATATTTGCAAATCATAAACCTAATAAGAGATCTGTGTCAAAAATATA
AGGAATTTGTACAATTTCATAGGCAAAGCTACCAAATAACCTGATTTAAAATGAGCAAAG
GGATTAAATCAATGTTTTTCCAGAGAAAAACTAAAAATGAGAAACAGATGTAGAAAAGAC
ACTTGGCACCACTACTATCCAGTGAAATGGGAACCAGGACTACAAGGAACTGTCACCTCC
CACATTTTAACATGGGTGTTACCAAAAGCAGAGGCAAAAGTTGGTCAGGATGCGGAGAAA
AGAAGGCACCGGCACACTTTGGGCATCCACTTGAGGCAGATGTGGTGTGGAACAGCCTGG
AGGGTCCTCAACATGCTTTAAACATAGGACCACCACACATGATCCAGCAGACTCTCTTCT
GGGATATGCCCTCCCCTCAAAAATAACTGAACCAGCACCTCTTAGAGACATCTGCACCCC
AGGTTTTATTGCAACATCATTCACAGTAGCAGAGACATGGAATCATCCTAAGTGTCCAAA
GACAGTAAATGGATTAATGGATTTTGGCACATGTGTATGAATATTATTCAGCCTTAAAAA
AGGAAAATACTGCTGTTTGCCATAACATGGATACACCTGTAAACCTGGAACACATTATGC
TGAGTAGGAGAAGTGAGAACAAGAAAGGAGAGTACTGCCCAGTCACACCTGTGAGTAGTG
TCTAGTAAGTCCCAAGATGCATACAGAGCATAAAAACTGGGGTTGACAACATGGCCTTTT
GATTGGAAGTCTGCTGAAAGTAGATTTAAGATGCTCTTAACACATGCATGCACACAATGA
TGAAGGTAGTTTGGTTTGCTAATTGCACTAGTCATTTTACTGTATATATGTGTATCAAAA
CAGCATGTTGTATACCTCAAGCATTCATTAAGAAAAAAATTGGGCTGCACCTGCACGTGG
CGCCAGGGGTCAGGCTGCAGCGCCAGAGGACATGCTCACACATAACTGGGGCCACCTGTT
TTGATGGCAGCCCTTTGAACTGTGAGCTACATAGCAAAAAAGAAAGAAAGAAAAAAGAAA
AAGAAAACAGTTGGGCTGTTAGGATACTTTATATTTGACACTTCCGTGTCCTCACCTTCC
ACCAAACACAAAATGGTCTTGCTGTGCCTCATTTTGATGATTAATCACCATCAATGTAGT
GTGTACTTTGCTTGCTGGAGTGAAATTAGGGTTCCGTGGTATGTAGTGACATGTGTCATA
GCTTCTGTCACTGACCTACGTGAGGGGCAGGCATGCCTTTGTGCTGTCTATTTACCCATA
CCAAGAAAGTCAACCTCTCAGTGAGTGCAAGGCAGGGGCCAGAGAACGTGGCTACTCAGT
AGCATAACCTGAGCCGGAGTGCAAGCCCCTTGACTTCAAGCCAGGCCGTGCTGGTGCTTC
TTATCACATCACATCCTGCTTTGCTACTGAGTCATTTAAAACAACTGTGGTTGACCTTTC
AATCACGAGCACCAGCACTAAGTGAGAACACATCCACACATCCCCAGTAGCAGCCTCAGC
ACCAGCAGCACCAGCAGCACCAGCAGCACCAGCAGCAGCACCACCATCTTGCCGCCACCA
ACATCAGCACCATCTTCATCAGCATCAATAATTACGTTGTCTCCTCTTCCTCCAGTGCTC
TTCTGTATTAAAAAAAGCCAACTTTAGTGTCTCCATTGATTTTCAGCCACAAATATATCA
TTTCCCCCTCCATATTTCCCAATAAAAATATTTCCTCAGGAATGCAAGAAACAAACATAA
AGATATTAAAGAAATTCAATTGAGGTGATGTGAAGCCCCTAGACACATTTCTCCTATTTC
TGGAGTTGAAGTGGTTTCTTATTGCATTGGGAAGGAGAATGCTTTCACACATTTCAGCAA
GCCTAGGGAGGCAAAGATGCTTGAGACAGGTGTTAAAATGTTATTCCATTATTTAGGGAC
AAAATTAAGGTTAAAGCCACCCTAGTACTTACTGTGTAAATACTCTCTCTTGAATATTGA
TGCTTCTGAAGATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved