Spermophilus_tridecemlineatus Locus Mono:149:SNORD113
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:149:SNORD113
Spermophilus_tridecemlineatus
Mono:149:SNORD113
GeneScaffold_1006
SNORD113
1001..1071
2071
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTTTAGTAC
CAAGTTTGAGTTGAAACGGAGAAATGTTTTTCCTAGTAAGTTCAAAGGAAATAAATATCA
TCAACTTGCAAAGAAGGGTCTTTAAATTGGTCATCATTCTCGCTTGAAGAAAGTGAAGGG
TAATTAAATAACTTAATAAATAAATCAATGTGGGACGTGCATGGACCAGTGATGAGATCA
TGTTATGAAGCAGAGTTTATGATTAATCCAGTTCTGTGCACCTGAGGTCCAATAAAAAAA
ATCTGAAAAGCCAGAGAAATGACATTAATTAGAATAAAAACCAAAGGTAAATCATTGAGC
CTTTTCATCCTTTTTTAATTTAAAGCATAAATAAATATGCAACCATAAAATAAGATTTAA
TTTTTTAGAATAGCCTCATATCATCAACCACAAACCAAGATTTCAAGAAAAGTAAATACT
AAATTCTCAGAAATACTTCTTTGTGTAATGGAGGCAAACCAGACTTTCAGAAGAAAAGAA
TGTGATTTCTTTTCCTGAAAAGACATTTTAAGATTGTTTTCATAGTCTAACTAGAACATT
TAAATTTTTGTGCAATGCAATGTGATCATATATATTTTAAATGATTTAATAGTAAAGCTT
CAAACTACTGGCAAGCATTTGTTTTCTCTAACTAGAAAGAAAACTATGTAAAACTATGTT
AAATAAATAATTTATAGAAGTGGTTTATCAGAGCTATTAACTATTAACTACTGATATTTT
AAAAGTTGCAATTTAGGGAAAACAAACATCAGCCAATAACTTAAAAAGACTGAAATTATA
TGGGTGGTGGAGGGGTTATCTCACTTGCATTTACAAGGACCTGTAAAGAATAAATATACT
CCCCTCTAAGAAATCAAGACAACAAAAATATACCAATTAAGACCAATACCAAGGCCAGGC
ATGGTAGAATAACCCTGTATTCCCAGAGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved