Spermophilus_tridecemlineatus Locus Mono:152:SNORA13
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:152:SNORA13
Spermophilus_tridecemlineatus
Mono:152:SNORA13
GeneScaffold_6141
SNORA13
1001..1133
2133
TGGGTTATGTCCGCTGCTCAGTACTGACCACACGTTATCAACCCTGGGAGGAGGGATGG
TAGGATATCCACCTTTGATAAAACCTCCTTCCCTACCGAAAACACTGGTCACCCATCCTC
AAACGGGACCTTCCCTCCTCTCCTCTTTCCTTAAGAAACCAGTCCCACAGCCCCTCACTG
AGCGCTTTTCCCTCCGGCCACATGGCGGCACACGAGAGTACGGCAGCCTATGGTACAGTC
CGTTCTCCCCGCGCCTTTAGCACAGTGGACCCTTCCAGTCGTTGAAAAGCATTGTGGGAG
GCCCATTCTGCCTTTTTCTTCCTATTCTTCTCGCGGTCTGTGGTGTGCTTGGGGTCCCGG
CATGGCTAGTGGCGGCCACGCGGCTTCCCGCGCCCGAGCGCCGGGCTTCGGAGGAATAAG
GGCGACTGCCCTGAGCCTGATGAGGCGCCTGCGATGGCTGGGCCACGATTAAGAGTCCGG
GACTCAAATGCGCACGGCAGCGGCCTAACCTTAAGGGCCACATCCTCCGAGGATCTGAGT
GAGGGCCTGAGGCCGACTTCGGCCTGTATTCCCTTCCCGGGAAATGGGACATTAACTAGA
TTTGCTTTTATTGATCGCCGATTGTACGCCAGGGAGTCTTGGGCGTAAGTACAAATCTCT
TTTGCGTGACCCGGGAAGGCCCCACGATGTAAATGGCTTTGTGCCTGCCCGAGCTCACTG
TGAAGTGGGTCGAGTGCCCTTTGAAATGCAGATCACTACACGTGTCCTCTGGCGCAGAGG
TTGGCCGAAACTGAATGAGTATCACCAACTTTGTAGGTAAGTTTTCTTGTAAGCAAACTG
ACCAGCTTACTCGGGATAAGAATTGTAACCCACCGTTTAAAGTTTTGTTTCAATTTTCAT
TAACGGGTAGGATTAGTTGTATTCTTTTCAAGCAGTAAGCACTTCATCTCAGCCAGTCAG
CAGCCTCTGCCATGGTAGAGCCAAACTTTTTGTTTTCACGGAGCCTTTGTGTTGCCCGTT
CACTTTTGTAAACTAGTGAATGTGGTGTCAAAAAAGGCACAAATAAATACTTTGCAGCCT
TTTCCTGCCCTTAAATTTTATATTTTTGGTGTAGGAACTGCATAAGTGACAGTTTGCATT
TACATTAATTTGTATATACATGCGTCGAACAGTGTTCAGTATGTGTTTCTTGTAACCTGT
TTCAACTAATTTTTGTTCAGGTGAAAAATGGATGCCTGAAGTGGACTACTGATCTCTGAA
CACTTGAGCACAAAGGTGACTTAAGGTAGGATGATATCAAAGTAGAAGTTGTGGAGGTTT
GATCTTTTTCTTGAGTAGGCAATATTGAAGAGAAAAAGTAAAAACATAGTACTCTACTTC
TGGATATCATTAGATTTGTTTCTTTCTAGTAAATGTAAAAAAAAACTTGATAAATCTCAA
GCATAAAATCCAGAAATGATATGACTTTTAATTCTGACATTGATTTATTATTACTAAGTT
CTTTATTAATATATTAGAATGTAATGTGTAAATATATACTTTTCAAATTGAGTATTTTCT
TTTATTTCAGGACATCCTTGGTACGGATTTTGGAAGTTTGGTCTTCAAAAGTTGCTTGAT
CATTTTAAAAATTTCCAGGAGTCTGAGGAGTATTGAAATAATTGGGTCTGTGGCTCAGCG
GTAGCACACGTACCTGGCATGTTTGGGTTTGATTCTCAACACAGCATATAAGTAAATAAA
ATAAATTTCTATTGACAATTTTTTTAATATTAAAAAACAATCAGTGCTATCATGGCCACT
GATGGTCTTATGATAGCTTCTGGCAAGCCGAAGGGAAATAAATACTTTTCTTCCCATGAA
TTCAAACTACTATGGTTTTCTTGAATTTAAGACACTGGGTAATGATTCTTCCTTTACTTA
ATAGGAAAGAGCAAATAGTGTTTTCAGGCATTCAGAATTTTATTTAAAAGTAATGTATTA
GGATCTGGGAACACAATGATAAGCAAAACAGTTCCACCCGCTGGGACCCTTTATCCGAGT
CAAATATCACAAAAGTAAAGCTTCCTTTGTGAGATGAATACCACAGTGAGATTTGACCAC
ATCTGGGAAACCTGAGAAAGCAAAGTTGACTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved